| Citation: |
Yexi Zhao, Jiayu Zhang, Zihan Li, Qinmijia Xie, Xin Deng, Chenxi Zhang, Nan Wang. 2024: Use of evergreen and deciduous plants by nocturnal-roosting birds: A case study in Beijing. Avian Research, 15(1): 100177. DOI: 10.1016/j.avrs.2024.100177
|
With continually increasing urbanization, the land cover in urban areas continues to change, resulting in the loss of biodiversity. Birds are highly sensitive to changes in habitat. Most forest birds perch on plants that provide increased safety to reduce the risk of predation, and small birds may also consider insulation when using roosting plants in winter because of cold weather. Landscaping plants thus shape the nocturnal roosting environment of urban birds, and proper planting is essential for the survival of birds at night. The use of roosting plants by urban birds should therefore be studied to provide a reference for landscaping. In the current study, we observed 1865 nocturnal roosting birds in Beijing from 2021 to 2022, with 23 species of birds from 12 families and 45 species of plants from 22 families recorded. Juniperus chinensis exhibited the highest bird rarity-weighted richness, followed by Fraxinus pennsylvanica, Phyllostachys propinqua, Pinus tabuliformis, and Ulmus pumila. The diameter at breast height, tree height, and crown width of plants used by birds was largest in summer and smallest in winter, and the perch height of birds was the highest in spring and summer and the lowest in winter. Birds used the highest proportion of deciduous plants in summer and the highest proportion of evergreen plants in winter. A significant seasonal difference in the use of evergreen and deciduous plants by small birds was noted, with a preference for deciduous plants in summer and evergreen plants in winter, while this preference was not found in large birds. These findings indicate that evergreen plants provide a vital nocturnal roosting environment for small birds in winter. To provide a better nocturnal roosting habitat for urban birds, we recommend paying attention to the combination of evergreen and deciduous plants when carrying out landscape construction.
The Grey Partridge (Perdix perdix Linnaeus, 1758) is a polytypic Galliform species included in the Least Concern (LC) category of the IUCN Red List of Threatened Species at both global (Staneva and Burfield 2017) and national scale (Peronace et al. 2012). Considering that, to date, Grey Partridge's population genetics is based on mtDNA (Andersen and Kahlert 2012), and that heteroplasmy has been previously described specifically in hybrids and other Galliform species (Barr et al. 2005; Gandolfi et al. 2017), we decided to investigate the presence of this phenomenon in P. perdix.
During this research, both wild and farm animals were analyzed (102 samples, Additional file 1); as concerns wild animals, both present and historical (see Gandolfi et al. 2017 for "historical" definition), P. perdix samples were characterized, whereas as to contemporary live samples, non-invasive specimens belonged both to husbandries or were sampled in nature (feather or faeces).
DNA was extracted through a specifically modified protocol (Lucentini et al. 2010), and two mitochondrial genes, Cytochrome Oxidase Subunit I (COI) and Control Region (CR/D-loop), were amplified (Kerr et al. 2007; Barbanera et al. 2009) and Sanger sequencing was outsourced for both ends of amplicons to Eurofins Genomics.
All sequences of 561 bp for D-loop and of 334 bp for COI were screened manually looking for double peaks in order to evaluate the presence and to validate point heteroplasmy (Ramos et al. 2013). We found out that, out of 102 individuals, nine showed point heteroplasmy in the D-loop fragment (Fig. 1A), and two in COI gene. Both mutations are missense, causing in the first case the substitution of an Isoleucine (AUU) by a Serine (AGU) while in the other case a Glycine (CAA) was substituted by an Arginine (CGA).
Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for D-loop and MN480303–MN480304, MT649229–MT649247 for COI).
Specimens presenting clear heteroplasmic D-loop single mutation sites and others showing electropherograms suggesting D-loop heteroplasmy insertion/deletion, were cloned using pGEM-T Easy vector (Promega) following the manufacturer's instructions. The analysis of clones strongly confirms the presence of heteroplasmy and the absence of any contamination. In fact, obtained clones, when sequenced, showed two different haplotypes, confirming the presence of more than one mtDNA in each cloned sample (Fig. 1B).
Furthermore, to rule out possible contaminations, 39 individuals, including the nine heteroplasmic ones, were genotyped with a nuclear gene, the Oocyte maturation factor (c-mos) using both primers appropriately designed for this purpose (CMOS2F; F5′-3′GCTGTGAAGCAAGTGAAGAA; CMOS2 R; R5′-3′AGCCGAAGTCTCCAATCTT) and those described by Shen et al. (2014). The analysis of this nuclear locus never showed any double peaks and/or signal superimposition, thus excluding the presence of sample contamination. Obtained related sequences were registered in GenBank (MN442418–MN442421).
In conclusion, this study provides the first evidence of mitochondrial heteroplasmy in Perdix perdix, a phenomenon that can create some ambiguities in phylogenetic and evolutionary interpretations. In fact, paternal mtDNA could lead to inaccurate estimates of divergence times if the molecular clock is used, and could confuse the putative haplogroup assignment. Furthermore, the data obtained, suggesting the occurrence of hybridization in Perdix perdix, strongly underlined the importance of the rapid adoption of control measures aimed to prevent the introduction of genomes from different geographical areas and to avoid the concrete risk of an extinction vortex to which the residual, small and isolated populations are segregated.
Further researches should focus to advance the knowledge on the hybridization scheme of Perdix species and on the possible interfertile species, to better understand the evolutionary history of the species and its management.
Supplementary information accompanies this paper at https://doi.org/10.1186/s40657-020-00213-w.
Authors would like to thank the Natural History Museum of the University of Pisa, the Civic Museum of Zoology of Rome, the Casalina's Gallery of Natural History and the Natural History Museum of Fisiocritici of Siena.
AA, PV and LL conceived and designed the research. PV, PS and AA acquired samples. CP, FG and LL performed the sample analysis. LL, AF and AA analyzed the data. PV, LL, CP, FS, IDR and AA conducted manuscript preparation, revising and analysis of intellectual contents. LL and AA contributed equally to the extent of this research. All authors read and approved the final manuscript.
Sample number and origin of each sample was reported. In particular a geographical origin or a museum/collection collocation was specified, if applicable. Furthermore, details about GenBank code on D-Loop, COI and c-mos fragment were provided. Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for Dloop, MN480303–MN480304, MT649229–MT649247 for COI and MN442418–MN442421 for c-mos).
The performed sampling procedures and analyses are consistent with the Directive 2010/63/EU, the Italian national regulations and the indications of the Ethics Committee of the Universities of Perugia and Viterbo (Italy). The approval by the Ethics Committee was not necessary because of the nature of the samples (museal individuals) and of the non-invasive in vivo sampling method. In fact, just two feathers were collected from live animals excluding those having a functional role. Birds were immediately released at the same sampling site. The sampling campaign was authorized by local authorities with the scientific ISPRA authorization number 12184.
Not applicable.
The authors declare that they have no competing interests.
|
Bao, M., Yang, S., Yang, Y., Zhou, S., Li, C., 2019. Tolerance distance of common birds to human disturbances in urban areas. J. Biol. 36, 55–59.
|
|
Deng, W.H., Gao, W., Guang, M., 2003. Nest and roost habitat characteristics of the grey-faced buzzard in northeastern China. J. Raptor Res. 37, 228–235.
|
|
Hu, N., Wang, Y.H., Li, X., 2018. Construction of campus green space from the perspective of green campus—taking Beijing Forestry University as example. Landsc. Archit. 25, 25–31.
|
|
Jhenkhar, M., Jadeyegowda, M., Kushalappa, C., Ramesh, M.N., Sathish, B.N., 2016. Bird diversity across different vegetation types in kodagu, central western ghats, India. Int. J. Zool. Res. 6, 25–36.
|
|
Jiang, X.Y., Zhang, C.J., Zhou, B., Liang, W., 2021. Sleeping in a noisy world: roosting sites of large aggregations of White Wagtails Motacilla alba in a tropical city, China. Ornithol. Sci. 20, 109–113.
|
|
Kemp, D.D., 2004. Exploring Environmental Issues: an Integrated Approach. Routledge, London.
|
|
Liu, Z.L., Ma, H.H., Dai, S.L., 2003. Representation of winter plants in the northern garden landscape. J. Hebei For. Sci. Tech. 1, 47–50.
|
|
Melles, S., Glenn, S.M., Martin, K., 2003. Urban bird diversity and landscape complexity: species–environment associations along a multiscale habitat gradient. Ecol. Soc. 7, 5.
|
|
Morrison, M., With, K.A., Timossi, I., 1986. The structure of a forest bird community during winter and summer. Wilson Bull. 98, 214–230.
|
|
Pan, Y., Gao, J.X., Zhou, K.X., An, S.Q., Yuan, B.D., 2019. Night roosting habitat selection of oriental magpie robin (Copsychus saularis) during breeding and non-breeding stages in urban green land. Chin. J. Ecol. 38, 2772–2779.
|
|
Phillips, C.E., Demaso, S.J., Kuvlesk, W.P., Brennan, L.A., Hewitt, D.G., 2011. Landscape metrics related to Rio Grande wild Turkey winter roosts in south Texas. Proc. Natl. Wild Turk. Symp. 10, 251–264.
|
|
R Core Team, 2021. R: a Language and Environment for Statistical Computing. R Foundation for Stat. Comput.
|
|
Sulaiman, S., Mohamad, N.H., Idilfitri, S., 2013. Contribution of vegetation in urban parks as habitat for selective bird community. Procedia–Soc. Behav. Sci. 85, 267–281.
|
|
Urban Socio-economic Surveys Group, 2001. China City Statistical Yearbook—2001. National Bureau of Statistics of China. China Statistics Press, Beijing.
|
|
Zhao, X.R., Zhu, L., Ye, H., Liu, M., Huang, H.C., Zhao, M., 2021. Birds of Beijing. China Forestry Publishing House, Beijing.
|
|
Zheng, G.M., 2023. A Checklist on the Classification and Distribution of the Birds of China, fourth ed. Science Press, Beijing.
|
|
Zheng, B.J., Dong, L., 2019. Study on plant landscape of Beijing urban linear parks based on bird diversity improvement. Landsc. Archit. 26, 53–57.
|
| 1. | Leonardo Brustenga, Giulia Rigamonti, Iolanda Moretta, et al. The Spiky Side of Urban Wildlife, First Detection of a Zoonotic Assemblage of Giardia duodenalis in European Hedgehogs (Erinaceus europaeus) from Italy. Acta Parasitologica, 2025, 70(2) DOI:10.1007/s11686-025-01009-y |
| 2. | Simona Gabrielli, Leonardo Brustenga, Giulia Morganti, et al. Genetic variability of Dirofilaria repens isolates from humans and dogs in Italy. Veterinary Parasitology, 2024, 326: 110096. DOI:10.1016/j.vetpar.2023.110096 |
| 3. | Donato Traversa, Angela Di Cesare, Simone Morelli, et al. Hepatozoon spp. in stray cats from the metropolitan area of Rio de Janeiro, Brazil. Parasite, 2024, 31: 24. DOI:10.1051/parasite/2024026 |
| 4. | L. Brustenga, S. Massetti, C. Paletta, et al. Shaping young naturalists, owl pellets dissection to train high-school students in comparative anatomy and molecular biology. Journal of Biological Education, 2024. DOI:10.1080/00219266.2024.2386252 |
| 5. | Claudia Greco, Cristiano Tabarroni, Irene Pellegrino, et al. Combining Historical and Molecular Data to Study Nearly Extinct Native Italian Grey Partridge (Perdix perdix) at the Turn of the Twentieth Century. Biology, 2024, 13(9): 709. DOI:10.3390/biology13090709 |
| 6. | Diletta Santovito, Leonardo Brustenga, Livia Lucentini, et al. Negative Evidence for Sex-Linked Heteroplasmy in the Nemertean Worm Notospermus geniculatus (Delle Chiaje, 1822). Sustainability, 2023, 15(13): 10212. DOI:10.3390/su151310212 |
| 7. | Leonardo Brustenga, Paolo Viola, Pedro Girotti, et al. An Updated List of Rock Partridge (Alectoris graeca) Haplotypes from the Apennines—Central Italy. Data, 2022, 7(9): 124. DOI:10.3390/data7090124 |
| 8. | Kai Liu, Nan Xie, Heng-Jia Ma. Next-generation sequencing reveals the mitogenomic heteroplasmy in the topmouth culter (Culter alburnus Basilewsky, 1855). Molecular Biology Reports, 2022, 49(2): 943. DOI:10.1007/s11033-021-06913-w |
| 9. | Diego Fontaneto, Paolo Viola, Claudia Pizzirani, et al. Mismatches between Morphology and DNA in Italian Partridges May Not Be Explained Only by Recent Artificial Release of Farm-Reared Birds. Animals, 2022, 12(5): 541. DOI:10.3390/ani12050541 |
| 10. | Kemal Karabağ, Emel Tüten Sevim, Şadiye Taşbaş. Genetic Relationships Between Commercially Produced and Natural Populations of Bombus Terrestris Dalmatinus in Terms of Mitochondrial COI and CytB. Journal of Apicultural Science, 2021, 65(2): 315. DOI:10.2478/jas-2021-0025 |
Figures(5)
DownLoad:
Email Alerts
RSS Feeds