Volume 7 Issue 1
Dec.  2019
Turn off MathJax
Article Contents
Abstract
Introduction
Materials and methods
Results
Acknowledgements
References
Saâd Hanane. 2016: Effects of location, orchard type, laying period and nest position on the reproductive performance of Turtle Doves (Streptopelia turtur) on intensively cultivated farmland. Avian Research, 7(1): 4. DOI: 10.1186/s40657-016-0039-0
Citation: Saâd Hanane. 2016: Effects of location, orchard type, laying period and nest position on the reproductive performance of Turtle Doves (Streptopelia turtur) on intensively cultivated farmland. Avian Research, 7(1): 4. DOI: 10.1186/s40657-016-0039-0
shu

Effects of location, orchard type, laying period and nest position on the reproductive performance of Turtle Doves (Streptopelia turtur) on intensively cultivated farmland

More Information
  • Corresponding author:

    Saâd Hanane, sd_hne@yahoo.fr

  • Received Date: 08 Jun 2015
  • Accepted Date: 11 Feb 2016
  • Available Online: 24 Apr 2022
  • Publish Date: 28 Feb 2016
    Graphical Abstract
    • Abstract
  • Background 

    Until recently little was known about factors affecting reproductive parameters of the Turtle Dove (Streptopelia turtur) on intensively cultivated farmland in the Mediterranean area. In this study, the reproductive parameters of this game species were evaluated in relation to location, orchard type, laying period and nest position in central Morocco.

    Methods 

    A total of 317 nests were found and analyzed across five breeding seasons (2004–2008) in the Haouz and Tadla regions, over two major agro-ecosystems made up of olive and orange orchards. Nest position, laying period, clutch size and the number of chicks hatched and fledged per nest were determined on 120 study plots. I used Generalized Linear Models (GLMs) with a Poisson distribution and a log link function, including the logarithm of the number of eggs in each clutch as an offset to model the number of chicks hatched and fledged per nest.

    Results 

    Clutch-size was not affected by location, orchard type, laying period or nest position. The number of chicks hatched per nest differed between orchard types; they were greater in olive orchards (1.33 ± 0.06) than in orange ones (1.03 ± 0.08), whereas the number of chicks fledged per nest consistently differed with laying period and orchard type, which were higher in the early laying period (1.22 ± 0.07) than in the late period (0.93 ± 0.08) and higher in olive orchards (1.22 ± 0.06) than in orange orchards (0.90 ± 0.06). Neither location nor nest position were related to variation in the fledging success of the Turtle Dove.

    Conclusions 

    Olive orchards and the early laying period confer better nesting conditions than orange orchards and the late laying period. Although nest position could be different in each orchard type, it did not affect the breeding success of the Turtle Dove, suggesting that factors other than tree characteristics are influential. Further studies are needed to improve our understanding of the effects of anthropogenic disturbance, especially agricultural activities and hunting, on the productivity of Turtle Dove nests.

    • FullText(HTML)

  • Microsatellites are also known as simple sequence repeats (SSRs), and are a few nucleotide sequence repeats distributed randomly in eukaryotic genomes. SSR markers are important tools to assess genetic diversity in avian because of their high level of polymorphism and codominant Mendelian inheritance (e.g. Randi et al., 2003). The Chinese Bamboo Partridge (Bambusicola thoracica) is an endemic gamebird that used to be widely distributed in temperate and subtropical forests of central and southeast China (Cheng, 1978; Johnsgard, 1999). At present, many studies have been conducted on the reproduction, habitat, anatomy and taxonomy of this bird (Chang et al., 1998; Lei and Lu, 2006; Huang et al., 2008; Yao et al., 2008). However, there are no molecular markers, such as SSRs isolated and applied in this species to date in spite of many molecular markers that have been developed and used broadly in other gamebirds (He et al., 2009; Wang et al., 2009; Zhou and Zhang, 2009). The lack of sufficient and polymorphic SSR markers limits research in genetic diversity for conservation purpose of this species. Thus, screening for polymorphic microsatellite markers in the Chinese Bamboo Partridge is very important and necessary for analyzing genome organization and evolution and developing marker-assisted breeding technology. In this study, we obtained ten polymorphic microsatellite loci for this partridge from its relative species, Gallus gallus, through cross-species amplification.

    In order to characterize isolated microsatellite markers, twenty samples of Chinese Bamboo Partridge were collected from Jinggangshan (26°22′N, 114°05′E), Jiangxi Province in China during two consecutive hunting seasons (2007 and 2008). Liver/muscle samples were dissected from birds and stored in 100% ethanol immediately after removal. Genomic DNA was extracted from livers/muscles using the standard phenol/chloroform method.

    The sibling taxa of Chinese Bamboo Partridge is Gallus gallus (Kimball et al., 1999). Therefore we selected a subset (n = 50) of G. gallus microsatellite primers for PCR amplification. PCR was carried out in a 30 μL mixture containing 100 ng DNA, 0.25 μM of each primer, 10× PCR buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP and 1U Taq polymerase (all reagents were from Dingguo Bio., Beijing, China). Amplification conditions were as follows: 94℃ for 4 min, then 94℃ for 30 s, annealing temperature for 15 s (Table 1), 72℃ for 20 s for 30 cycles, then 72℃ for 10 min in a PE9600 thermocycler. The PCR products were separated on an ABI377 PRISMTM DNA sequencer (ABI). Fragment lengths were assigned using Gene Scan software 3.1 (ABI). Of the 30 primer sets screened, 13 exhibited polymorphism (Table 1).

    Table  1.  Characteristics of ten polymorphic microsatellite loci in Bambusicola thoracica
    Locus ID Primer sequences Repeat
    motif    		 Ta
    (℃)    		 Observed allele size range (bp) Na HO HE p
    ADL268 F: CTCCACCCCTCTCAGAACTA
    R: CAACTTCCCATCTACCTACT    		 (GT)12 60 90–120 5 0.6098 0.4788 0.0887
    ADL136 F: TGTCAAGCCCATCGTATCAC
    R: CCACCTCCTTCTCCTGTTCA    		 (TG)20 56 98–134 13 0.7105 0.8898 0.0000*
    MCW0016 F: ATGGCGCAGAAGGCAAAGCGATAT
    R: TGGCTTCTGAAGCAGTTGCTATGG    		 (TG)16 62 104–126 4 0.6000 0.4459 0.0942
    MCW067 F: GCACTACTGTGTGCTGCAGTTT
    R: GAGATGTAGTTGCCACATTCCGAC    		 (TA)6 + (TG)11 56 162–188 11 0.5000 0.8060 0.0000*
    MCW069 F: GCACTCGAGAAAACTTCCTGCG
    R: TTGCTTCAGCAAGCATGGGAGGA    		 (CA)11 58 152–166 8 0.7073 0.7148 0.1089
    MCW0111 F: GCTCCATGTGAAGTGGTTTA
    R: ATGTCCACTTGTCAATGATG    		 (CA)7 57 80–102 9 1.0000 0.7338 0.0000*
    MCW0216 F: GGGTTTTACAGGATGGGACG
    R: AGTTTCACTCCCAGGGCTCG    		 (GT)9 60 142–154 4 0.1220 0.1183 1.0000
    MCW222 F: GCAGTTACATTGAAATGATTCC
    R: TTCTCAAAACACCTAGAAGAC    		 (GT)8 62 190–216 5 0.2439 0.2671 0.1000
    MCW0295 F: ATCACTACAGAACACCCTCTC
    R: TATGTATGCACGCAGATATCC    		 (AC)10 + (AT)4 + (ATAC)3 60 86–144 4 0.5854 0.5086 0.6300
    LEI0192 F: TGCCAGAGCTTCAGTCTGT
    R: GTCATTACTGTTATGTTTATTGC    		 (TTTC)12 56 250–376 12 0.4000 0.6671 0.0000*
    Ta, annealing temperature; Na, number of alleles; HE, expected heterozygosity; HO, observed heterozygosity.
    * means p < 0.05.
     | Show Table
    DownLoad: CSV

    For each polymorphic locus, we calculated the observed heterozygosity (HO) and expected heterozygosity (HE) using GENEPOP version 3.4 (Raymond and Rousset, 2000). GENEPOP was also used to test for evidence of linkage disequilibrium and deviation from the Hardy-Weinberg equilibrium.

    The number of alleles per locus was 4–13. The observed heterozygosity ranged from 0.1220 to 1.0000 and the expected heterozygosity from 0.1183 to 0.8898 (Table 1). The observed heterozygosity of all loci was consistent with that expected under the Hardy-Weinberg equilibrium after a Bonferroni correction (p < 0.05), except for ADL136, MCW067, LEI0166 and LEI0192. Fifteen pairs of loci showed significant linkage disequilibrium values at p < 0.05 among the 78 pair-wise tests. These markers are potentially useful for studies on phylogeography and conservation genetics of the Chinese Bamboo Partridge.

    We thank Mr Minsheng Liu for his assistance in obtaining samples. We also thank the Dingguo Bio. Ltd. for providing technological help. The study was supported by the National Natural Science Foundation of China (Grant No. 30760036, 30960051), Young Scientists (Jinggang Star) Training Scheme of Jiangxi Province, and Natural Science Foundation of Jiangxi Province (2009GZN0075).

    • References (74)
  • Bakaloudis DE, Vlachos CG, Chatzinikos E, Bontzorlos V, Papakosta M. Breeding habitats preferences of the turtledove (Streptopelia turtur) in the Dadia-Soufli National Park and its implications for management. Eur J Wildl Res. 2009;55:597-602.
    Barea LP. Nest-site selection by the Painted Honeyeater (Grantiella picta), a mistletoe specialist. Emu. 2008;108:213-20.
    Belda A, Martinez-Perez JE, Peiro V, Seva E, Arques J. Main landscape metrics affecting abundance and diversity of game species in a semi-arid agroecosystem in the Mediterranean region. Span J Agric Res. 2011;9(4):1197-212.
    Benton TG, Vickery JA, Wilson JD. Farmland biodiversity: is habitat heterogeneity the key? Trend Ecol Evol. 2003;18:182-8.
    Boutin JM. Elements for a Turtle Dove (Streptopelia turtur) management plan. Game Wildl. 2001;18:87-112.
    Boutin JM, Lutz M. Management plan for Turtle Dove (Streptopelia turtur) 2007-2009. Luxembourg: European Commission; 2007.
    Browne S, Aebischer N. The role of agricultural intensification in the decline of the Turtle Dove Streptopelia turtur. Peterborough: English Nature; 2001.
    Browne SJ, Aebischer N, Crick H. Breeding ecology of Turtle Doves Streptopelia turtur in Britain during the period 1941-2000: an analysis of BTO nest records cards. Bird Study. 2005;52:1-9.
    Browne SJ, Aebischer NJ, Yfantis G, Marchant JH. Habitat availability and use by Turtle dove Streptopelia turtur between 1965 and 1995: an analysis of Common Birds Census data. Bird Study. 2004;51:1-11.
    Browne SJ, Aebischer NJ. Habitat use, foraging ecology and diet of Turtle Doves Streptopelia turtur in Britain. Ibis. 2003;145:572-82.
    Burnham KP, Anderson DR. Model selection and multimodel inference: a practical information theoretic approach. New York: Springer; 2002.
    Buruaga MSD, Onrubia A, Fernandez-Garcia JM, Campos MÁ, Canales F, Unamuno JM. Breeding habitat use and conservation status of the Turtle Dove Streptopelia turtur in Northern Spain. Ardeola. 2012;59:291-300.
    Crabtree RL, Brooye LS, Wolfe ML. Effects of habitat characteristics on gadwall nest predation and nest-site selection. J Wildl Manag. 1989;53:129-37.
    Cramp S. The birds of the western palearctic, vol. 4. Oxford: Oxford University Press; 1985.
    Dean WRJ. Bird assemblages as clues to dryland alteration (poster abstract). In: Arid Zone ecology forum, De Aar, 10-12 November 1992. p 25.
    Dias S, Moreira F, Beja P, Carvalho M, Gordinho L, Reino L, Oliveira V, Rego F. Landscape effects on large scale abundance patterns of turtle doves Streptopelia turtur in Portugal. Eur J Wildl Res. 2013;59:531-41.
    Dray S, Dufour AB (2007) The ade4 Package: implementing the duality diagram for ecologists. J Stat Softw. 2007;22(4): 1-20. ().
    Drobney RD, Schulz JH, Sheriff SL, Fuemmeler WJ. Mourning Dove nesting habitat and nest success in central Missouri. J Field Ornithol. 1998;69(2):299-305.
    Dunn JC, Morris AJ. Which features of UK farmland are important in retaining territories of the rapidly declining Turtle dove Streptopelia turtur? Bird Study. 2012;59:394-402.
    Eraud C, Boutin J-M, Riviere M, Brun J, Barbraud C, Lormée H. Survival of Turtle doves Streptopelia turtur in relation to western Africa environmental conditions. Ibis. 2009;151:186-90.
    Eraud C, Rivière M, Lormée H, Fox JW, Ducamp J-J, Boutin J-M. Migration routes and staging areas of trans-Saharan Turtle Doves appraised from light level geolocators. PLoS ONE. 2013;8:e59396. doi: .
    Götmark F. The effects of investigator disturbance on nesting birds. Curr Ornithol. 1992;9:63-104.
    Hanane S, Baamal L. Are Moroccan fruit orchards suitable breeding habitats for Turtle Doves Streptopelia turtur? Bird Study. 2011;58:57-67.
    Hanane S, Bergier P, Thévenot M. La reproduction de la Tourterelle maillée Streptopelia senegalensis dans la plaine de Tadla (Maroc Central): analyse comparée avec la Tourterelle des bois Streptopelia turtur. Alauda. 2011;79(1):17-28.
    Hanane S, Besnard A. Are nest-detection probability methods relevant for estimating Turtle dove breeding populations? A case study in Moroccan agroecosystems. Eur J Wildl Res. 2014;60:673-80.
    Hanane S, Besnard A. Nest survival of Woodpigeons (Columba palumbus) in North African forests. Bird Study. 2013;60:202-10.
    Hanane S, Maghnouj M. Biologie de reproduction de la Tourterelle des bois Streptopelia turtur dans le périmètre irrigué du Haouz (Marrakech-Maroc). Alauda. 2005;73:183-94.
    Hanane S. Do age and type of plantings affect turtle dove Streptopelia turtur nest placement in olive agro-ecosystems? Ethol Ecol Evol. 2012;24:284-93.
    La Hanane S. Tourterelle des bois au Maroc: sur les traces d'un gibier. Rabat: Centre de Recherche Forestière, Collection Maroc Nature; 2009. p. 36.
    Hanane S. Nest-niche differentiation in two sympatric Streptopelia species from a North African agricultural area: the role of human presence. Ecol Res. 2015;30(4):573-80.
    Hanane S. Plasticity in nest placement of the Turtle Dove (Streptopelia turtur): experimental evidence from Moroccan agroecosystems. Avian Biol Res. 2014;7(2):65-73.
    Haut Commissariat aux Eaux et Forêts et à la Lutte Contre la Désertification (HCEFLCD). Rapport Annuel de la Chasse Saison 2012/2013. 2013, p 38.
    Heath M, Borggreve C, Peet N. European bird populations: estimates and trends. In: Birdlife conservation series no 10. Cambridge: Birdlife International/European Bird Census Council; 2000. p 160.
    Herényi M, Garamszegi LZ, Hargitai R, Hegyi G, Rosivall B, Szollosi E. Laying period and polygyny as determinants of annual reproductive success in male collared flycatchers (Ficedula albicollis): a long-term study. Naturwissenschaften. 2014;101:305-12.
    Isenmann P, Gaultier T, El Hili A, Azafzaf H, Dlensi H, Smart M. Oiseaux de Tunisie.[Birds of Tunisia.]. Paris: SEOF Editions; 2005. p. 432.
    Isenmann P, Moali A. Les Oiseaux d'Algérie.[Birds of Algeria.]. Paris: Société d'Étude Ornithologiques de France; 2000. p. 336.
    Kafi F, Hanane S, Bensouilah T, Zeraoula A, Brahmia H, Houhamdi M. Les facteurs déterminants le succès de reproduction de la Tourterelle des bois (Streptopelia turtur) dans un milieu agricole Nord-Africain. Revue d'Écologie (Terre Vie). 2015;70(3):271-9.
    Knight RL, Smith DG, Gaudet DM, Ericsson AW. Nesting ecology of Mourning Doves in fruit orchards in northcentral Washington. Northwest Sci. 1984;58:230-6.
    Legendre P, Legendre L. Numerical ecology. Amsterdam: Elsevier; 1998.
    Lepage D, Gauthier G, Menu S. Reproductive consequences of egg-laying decisions in snow geese. J Anim Ecol. 2000;69:414-27.
    Lomáscolo SB, Monmany AC, Malizia A, Martin TE. Flexibility in nest site choice and nesting success of Turdus Rufiventris (Turdidae) in a montane forest in northwestern Argentina. Wilson J Ornithol. 2010;122:674-80.
    Magnan A, Garnaud B, Billé R, Gemenne F, Hallegatte S. La Méditerranée au futur: des impacts du changement climatique aux enjeux de l'adaptation. Paris: Iddri series; 2009.
    Martin TE, Roper JJ. Nest predation and nest site selection of a western population of the hermit thrush. Condor. 1988;90:51-7.
    McCullagh P, Nelder JA. Generalized linear models, volume 37 of Monographs on statistics and applied probability. London: Chapman and Hall; 1989.
    McGarigal K, Cushman SA, Stafford S. Multivariate statistics for wildlife and ecology research. New York: Springer; 2000.
    Miller DA, Otis DL. Calibrating recruitment estimates for mourning doves from harvest age ratios. J Wildl Manag. 2010;74:1070-9.
    Ministère de l'Agriculture et de la Pêche Maritime (MAPMFF). Note sur l'irrigation au Maroc. Retrieved on May, 2015. 2015. (www.agriculture.gov.ma).
    Mitchell MC, Best LB, Gionfriddo JP. Avian nest site selection and nesting success in two Florida Citrus orchards. Wilson Bull. 1996;108:573-83.
    Nichols JD, Percivalr HF, Coon RA, Conroy MJ, Hensler GL, Hines JE. Observer visitation frequency and success of Mourning Dove nests: a field experiment. Auk. 1984;101:398-402.
    Peak RG. Forest edges negatively affect Golden-cheeked warbler nest survival. Condor. 2007;109:628-37.
    PECBMS. The State of Europe's Common Birds, 2008. CSO/RSPB. Prague: Czech Republic; 2010.
    Peiro V. Aspectos de la reproduccion de la Tortola común (Streptopelia turtur) en Madrid. Mediterr Ser Biol. 1990;12:89-96.
    Pimm SL, Gittleman JL. Biological diversity: where is it? Science. 1992;225:940.
    Ponz A, Barba E, Gil Delgado JA. Population changes and breeding ecology of the Cirl Bunting Emberisa cirlus in eastern Spain. Bird Study. 1996;43:38-46.
    Quinn GP, Keough MJ. Experimental design and data analysis for biologists. Cambridge: Cambridge University Press; 2002.
    R Development Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2013. (.).
    Rey PJ. Preserving frugivorous birds in agro-ecosystems: lessons from Spanish olive orchards. J Appl Ecol. 2011;48:228-37.
    Rivera-Milán FF, Ruiz CA, Cruz JA, Sustache JA. Reproduction of Plain Pigeons (Columba inornata wetmorei) in East-Central Puerto Rico. Auk. 2003;120:466-80.
    Rivera-Milán FF. Nest density and success of columbids in Puerto Rico. Condor. 1996;98:100-13.
    Rocha G, Hidalgo S. La Tortola común Streptopelia turtur. Analysis de los factores que afectan a su status. Badajoz: Universidad de Extramadura; 2002.
    Rouxel R. La tourterelle des bois (Streptopelia turtur): synthèse de données bibliographiques en Europe orientale. Bulletin de liaison et d'information d'OMPO (Oiseaux Migrateurs du Paléarctique Occidental)-Octobre. 2000;22:5-15.
    Sánchez-Oliver JS, Rey Benayas JM, Carrascal LM. Local habitat and landscape influence predation of bird nests on afforested Mediterranean cropland. Acta Oecol. 2014;58:35-43.
    Smith P, Heitjan F. Testing and adjusting for departures from nominal dispersion in generalized linear models. Appl Stat. 1993;42(1):31-4.
    Sokos CK, Mamolos AP, Kalburtji KL, Birtsas PK. Farming and wildlife in Mediterranean agroecosystems. J Nat Conserv. 2012;21:81-92.
    Sperry JH, Peak RG, Cimprich DA, Weatherhead PJ. Snake activity affects seasonal variation in nest predation risk for birds. J Avian Biol. 2008;39:379-83.
    Suvorov P, Svobodová J, Koubová M, Dohnalová L. Ground nest depredation by European black-billed magpies Pica pica: an experimental study with artificial nests. Acta Ornithol. 2012;47:55-61.
    Thévenot M, Vernon R, Bergier P. The birds of Morocco. Trin: British Ornithologists'Union/British Ornithologists'Club; 2003.
    Underwood AJ. Experiments in ecology. their logical design and interpretation using analysis of variance. Cambridge: Cambridge University Press; 1996.
    Westmoreland D, Best LB. Effects of researcher disturbance on Mourning Dove nesting success. Auk. 1985;102:774-80.
    Wiley JW. Ecology and behavior of the Zenaida Dove. Omitol Neotrop. 1991;2:49-75.
    Yahiaoui K, Arab K, Belhamra M, Browne SJ, Boutin J-M, Moali A. Habitat occupancy by European Turtle Dove (Streptopelia turtur) in the Isser Valley, Algeria. Rev Ecol (Terre Vie). 2014;69(3-4):234-46.
    Yahner RH. Seasonal dynamics, habitat relationships, and management of avifauna associated with farmstead shelterbelts. J Wildl Manag. 1983;47:85-104.
    Zar JH. Biostatistical analysis. Englewood Cliffs: Prentice-Hall Inc.; 1984. p. 717.
    Zárybnická M, Sedláček O, Salo P, Šťastný K, Korpimäki E. Reproductive responses of temperate and boreal Tengmalm's Owl Aegolius funereus populations to spatial and temporal variation in prey availability. Ibis. 2015;157(2):369-83.
    • Related Articles

  • Cited by

    Periodical cited type(14)

    1. Saâd Hanane, Mohamed Bouaamama, Ahmed Bougnous, et al. Contrasting occurrence patterns in the European turtle dove (Streptopelia turtur) in managed and unmanaged hunting forest estates: does human presence matter?. Biologia, 2023. DOI:10.1007/s11756-023-01324-7
    2. Mohamed Mounir, Ismail Mansouri, Wafae Squalli, et al. Spatial and Temporal Monitoring of North African Turtle Doves Streptopelia turtur arenicola (Hartert, EJO, 1894): First Migrants Arrive Early and Select Nesting Trees next to Foraging Resources while Second Breeders’ Wave Breed around Earlier Nests. International Journal of Zoology, 2023, 2023: 1. DOI:10.1155/2023/8863486
    3. Ismail Mansouri, Wafae Squalli, Abdelbari El Agy, et al. Analysis of Moroccan breeding and wintering population of the vulnerable European Turtle dove Streptopelia turtur: Breeding habitats, wintering sites and governing factors. Scientific African, 2022, 15: e01110. DOI:10.1016/j.sciaf.2022.e01110
    4. Wafae Squalli, Michael Wink, Ismail Mansouri, et al. High density and successful breeding of Turtle doves Streptopelia turtur in Moroccan olive groves. PeerJ, 2022, 10: e14375. DOI:10.7717/peerj.14375
    5. NASRINE SAÂD, SAÂD HANANE, KAMILIA FARHI, et al. Tree characteristics, microhabitat and edge effect in plantations govern European Turtle-doveStreptopelia turturnest habitat selection at the edge of Sahara: implications for conservation of a vulnerable species. Bird Conservation International, 2022, 32(2): 322. DOI:10.1017/S0959270921000290
    6. Carles Carboneras, Lara Moreno-Zarate, Beatriz Arroyo. The European Turtle Dove in the ecotone between woodland and farmland: multi-scale habitat associations and implications for the design of management interventions. Journal of Ornithology, 2022, 163(2): 339. DOI:10.1007/s10336-021-01946-1
    7. Wafae Squalli, Ismail Mansouri, Driss Ousaaid, et al. New Data on Breeding Strategies and Reproductive Success of the Globally Threatened Turtle Dove Co-Occurring with the “Competitive” Collared Dove and the “Predatory” Maghreb Magpie in Olive Orchards. International Journal of Zoology, 2022, 2022: 1. DOI:10.1155/2022/2864178
    8. Ismail Mansouri, Wafae Squalli, Abdelbari El Agy, et al. Comparison of Nesting Features and Breeding Success of Turtle Dove Streptopelia turtur between Orchards and Riparian Habitats. International Journal of Zoology, 2021, 2021: 1. DOI:10.1155/2021/5566398
    9. Foued Hamza, Asma Kahli, Mohamed-Ali Chokri, et al. Urban and industrial landscapes interact with microhabitat to predict occurrence of European Turtle Dove (Streptopelia turtur) in Mediterranean oases: Implications for conservation. Landscape and Urban Planning, 2021, 215: 104219. DOI:10.1016/j.landurbplan.2021.104219
    10. Nasrine Saâd, Saâd Hanane, Kamilia Farhi, et al. Nest Age as Predictor of Nest Survival in Three Sympatric Dove Species Breeding in a Mediterranean Arid Agroecosystem. Ardea, 2020, 108(2) DOI:10.5253/arde.v108i2.a5
    11. Ismail Mansouri, Mohamed Mounir, Wafae Squalli, et al. Migratory Dates, Breeding Phenology, and Reproductive Success of European Turtle Doves between Lowlands and Highest Breeding Habitats in North Africa. International Journal of Zoology, 2020, 2020: 1. DOI:10.1155/2020/8816577
    12. Ismail Mansouri, Mohammed K. Al-Sadoon, Mouad Rochdi, et al. Diversity of feeding habitats and diet composition in the turtle doves Streptopelia turtur to buffer loss and modification of natural habitats during breeding season. Saudi Journal of Biological Sciences, 2019, 26(5): 957. DOI:10.1016/j.sjbs.2018.11.006
    13. Saâd Hanane. Multi-scale turtle dove nest habitat selection in a Mediterranean agroforestry landscape: implications for the conservation of a vulnerable species. European Journal of Wildlife Research, 2018, 64(4) DOI:10.1007/s10344-018-1205-y
    14. Saâd Hanane. The European Turtle-DoveStreptopelia turturin Northwest Africa: A Review of Current Knowledge and Priorities for Future Research. Ardeola, 2017, 64(2): 273. DOI:10.13157/arla.64.2.2017.rp1

    Other cited types(0)

Catalog

    Figures(3)  /  Tables(4)

    Get Citation
    PDF
    XML

    Article Metrics

    Article has an altmetric score of 1
    Article has an altmetric score of 1
    Article views (435) PDF downloads (10) Cited by(14)
    Supported by: Beijing Renhe Information Technology Co. Ltd.   Technical support: info@rhhz.net

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return