| Citation: |
Bertille Mohring, François Brischoux, Frédéric Angelier. 2021: Vineyards, but not cities, are associated with lower presence of a generalist bird, the Common Blackbird (Turdus merula), in Western France. Avian Research, 12(1): 3. DOI: 10.1186/s40657-020-00239-0
|
Land-use change is one of the main drivers of the global erosion of biodiversity. In that context, it is crucial to understand how landscape characteristics drive the presence of rare endangered species. Nevertheless, it is also important to study common species in multiple habitats, because they represent a large proportion of biodiversity and are essential to maintain ecological functions. Interestingly, some habitats, as farmlands with permanent crops (e.g. vineyards), have been overlooked in the literature.
In this study, we investigated the distribution of a widespread and common bird species, the Common Blackbird (Turdus merula), within and between the three main habitats of our study area (rural Western France). We specifically focused on (1) woodlands, (2) farmlands with a high vineyard coverage, and (3) moderately urbanized areas. Specifically, we aimed to assess the beneficial and detrimental effects of these habitats and their fine-scale composition on the presence of a common bird species, relying on a survey by point counts (nearly 100 locations). We studied the effects of habitats and gradients of fine-scale habitat composition on blackbird presence using logistic regression analyses.
Blackbirds were present in all studied habitats. However, their presence varied between habitats, being lower in vineyards than in woodlands and cities. In woodlands and cities, fine-scale analyses did not reveal any component driving the species' presence. However, we found that shrub and tree vegetation cover had a significant positive effect on blackbird presence in vineyards.
Our results are in agreement with the definition of a generalist species. Interestingly, species distribution varied between habitats. The high presence of blackbirds in urban areas suggests that medium-sized cities, despite their artificialization, do not constrain the settlement of this former forest specialist and that green spaces may allow blackbirds to thrive in medium-sized cities. On the contrary, we found an impoverished presence of blackbirds in vineyards and a positive effect of vegetation on their presence in these landscapes. This suggests that permanent crops, and more generally farmlands, may impose important constraints to common species. Future studies should examine how to enhance biodiversity through agricultural management policies, especially in vineyards.
The Grey Partridge (Perdix perdix Linnaeus, 1758) is a polytypic Galliform species included in the Least Concern (LC) category of the IUCN Red List of Threatened Species at both global (Staneva and Burfield 2017) and national scale (Peronace et al. 2012). Considering that, to date, Grey Partridge's population genetics is based on mtDNA (Andersen and Kahlert 2012), and that heteroplasmy has been previously described specifically in hybrids and other Galliform species (Barr et al. 2005; Gandolfi et al. 2017), we decided to investigate the presence of this phenomenon in P. perdix.
During this research, both wild and farm animals were analyzed (102 samples, Additional file 1); as concerns wild animals, both present and historical (see Gandolfi et al. 2017 for "historical" definition), P. perdix samples were characterized, whereas as to contemporary live samples, non-invasive specimens belonged both to husbandries or were sampled in nature (feather or faeces).
DNA was extracted through a specifically modified protocol (Lucentini et al. 2010), and two mitochondrial genes, Cytochrome Oxidase Subunit I (COI) and Control Region (CR/D-loop), were amplified (Kerr et al. 2007; Barbanera et al. 2009) and Sanger sequencing was outsourced for both ends of amplicons to Eurofins Genomics.
All sequences of 561 bp for D-loop and of 334 bp for COI were screened manually looking for double peaks in order to evaluate the presence and to validate point heteroplasmy (Ramos et al. 2013). We found out that, out of 102 individuals, nine showed point heteroplasmy in the D-loop fragment (Fig. 1A), and two in COI gene. Both mutations are missense, causing in the first case the substitution of an Isoleucine (AUU) by a Serine (AGU) while in the other case a Glycine (CAA) was substituted by an Arginine (CGA).
Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for D-loop and MN480303–MN480304, MT649229–MT649247 for COI).
Specimens presenting clear heteroplasmic D-loop single mutation sites and others showing electropherograms suggesting D-loop heteroplasmy insertion/deletion, were cloned using pGEM-T Easy vector (Promega) following the manufacturer's instructions. The analysis of clones strongly confirms the presence of heteroplasmy and the absence of any contamination. In fact, obtained clones, when sequenced, showed two different haplotypes, confirming the presence of more than one mtDNA in each cloned sample (Fig. 1B).
Furthermore, to rule out possible contaminations, 39 individuals, including the nine heteroplasmic ones, were genotyped with a nuclear gene, the Oocyte maturation factor (c-mos) using both primers appropriately designed for this purpose (CMOS2F; F5′-3′GCTGTGAAGCAAGTGAAGAA; CMOS2 R; R5′-3′AGCCGAAGTCTCCAATCTT) and those described by Shen et al. (2014). The analysis of this nuclear locus never showed any double peaks and/or signal superimposition, thus excluding the presence of sample contamination. Obtained related sequences were registered in GenBank (MN442418–MN442421).
In conclusion, this study provides the first evidence of mitochondrial heteroplasmy in Perdix perdix, a phenomenon that can create some ambiguities in phylogenetic and evolutionary interpretations. In fact, paternal mtDNA could lead to inaccurate estimates of divergence times if the molecular clock is used, and could confuse the putative haplogroup assignment. Furthermore, the data obtained, suggesting the occurrence of hybridization in Perdix perdix, strongly underlined the importance of the rapid adoption of control measures aimed to prevent the introduction of genomes from different geographical areas and to avoid the concrete risk of an extinction vortex to which the residual, small and isolated populations are segregated.
Further researches should focus to advance the knowledge on the hybridization scheme of Perdix species and on the possible interfertile species, to better understand the evolutionary history of the species and its management.
Supplementary information accompanies this paper at https://doi.org/10.1186/s40657-020-00213-w.
Authors would like to thank the Natural History Museum of the University of Pisa, the Civic Museum of Zoology of Rome, the Casalina's Gallery of Natural History and the Natural History Museum of Fisiocritici of Siena.
AA, PV and LL conceived and designed the research. PV, PS and AA acquired samples. CP, FG and LL performed the sample analysis. LL, AF and AA analyzed the data. PV, LL, CP, FS, IDR and AA conducted manuscript preparation, revising and analysis of intellectual contents. LL and AA contributed equally to the extent of this research. All authors read and approved the final manuscript.
Sample number and origin of each sample was reported. In particular a geographical origin or a museum/collection collocation was specified, if applicable. Furthermore, details about GenBank code on D-Loop, COI and c-mos fragment were provided. Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for Dloop, MN480303–MN480304, MT649229–MT649247 for COI and MN442418–MN442421 for c-mos).
The performed sampling procedures and analyses are consistent with the Directive 2010/63/EU, the Italian national regulations and the indications of the Ethics Committee of the Universities of Perugia and Viterbo (Italy). The approval by the Ethics Committee was not necessary because of the nature of the samples (museal individuals) and of the non-invasive in vivo sampling method. In fact, just two feathers were collected from live animals excluding those having a functional role. Birds were immediately released at the same sampling site. The sampling campaign was authorized by local authorities with the scientific ISPRA authorization number 12184.
Not applicable.
The authors declare that they have no competing interests.
|
Abs M, Bergen F. A long term survey of the avifauna in an urban park. In: Marzluff JM, Shulenberger E, Endlicher W, Alberti M, Bradley G, Ryan C, et al., editors. Urban ecology: an international perspective on the interaction between humans and nature. Boston: Springer; 2008. p. 373–6.
|
|
Assandri G, Bogliani G, Pedrini P, Brambilla M. Insectivorous birds as 'non-traditional' flagship species in vineyards: applying a neglected conservation paradigm to agricultural systems. Ecol Indic. 2017a;80: 275–85.
|
|
Assandri G, Giacomazzo M, Brambilla M, Griggio M, Pedrini P. Nest density, nest-site selection, and breeding success of birds in vineyards: management implications for conservation in a highly intensive farming system. Biol Conserv. 2017b;205: 23–33.
|
|
Baillie J, Hilton-Taylor C, Stuart SN. IUCN red list of threatened species: a global species assessment. Gland: IUCN–The World Conservation Union; 2004.
|
|
Buckley NJ. The new atlas of breeding birds in Britain and Ireland: 1988–1991. In: Gibbons DW, Reid JB, Chapman RA, editors. The Auk. London: T & AD Poyser; 1995. p. 812–3.
|
|
Burnham KP, Anderson DR. Model selection and multi-model inference: a practical information-theoretic approach. 2nd ed. New York: Springer; 2002.
|
|
Clavel J, Julliard R, Devictor V. Worldwide decline of specialist species: toward a global functional homogenization? Front Ecol Environ. 2011;9: 222–8.
|
|
Dabelsteen T. Interactive playback: a finely tuned response. In: McGregor PK, editor. Playback and studies of animal communication. Boston: Springer; 1992. p. 97–109.
|
|
Fernández-Juricic E, Jimenez MD, Lucas E. Bird tolerance to human disturbance in urban parks of Madrid (Spain): management implications. In: Marzluff JM, Bowman R, Donnelly R, editors. Avian ecology and conservation in an urbanizing world. Boston: Springer; 2001. p. 259–73.
|
|
Guittet M, Sibe V, Gaudin J-C. Les vignobles: de nouveaux réservoirs de biodiversité. Faune sauvage. 2011: 9.
|
|
Hatchwell BJ, Chamberlain DE, Perrins CM. The demography of Blackbirds Turdus merula in rural habitats: is farmland a sub-optimal habitat? J Appl Ecol. 1996;33: 1114.
|
|
Lê S, Josse J, Husson F. FactoMineR: an R package for multivariate analysis. J Stat Softw. 2008;25: 1–18.
|
|
Lennon JJ, Beale CM, Reid CL, Kent M, Pakeman RJ. Are richness patterns of common and rare species equally well explained by environmental variables? Ecography. 2011;34: 529–39.
|
|
Luck GW, Smallbone LT. Species diversity and urbanisation: patterns, drivers and implications. In: Gaston KJ, editor. Urban Ecology. Cambridge: Cambridge University Press; 2010. p. 88–119.
|
|
Luniak M. Synurbization — adaptation of animal wildlife to urban development. In: Shaw WW, Harris LK, Vandruff L, editors. Proceedings 4th international urban wildlife symposium. Tucson, Arizona: University of Arizona; 2004. p. 50–5.
|
|
Mennechez G, Clergeau P. Effect of urbanisation on habitat generalists: starlings not so flexible? Acta Oecol. 2006;30: 182–91.
|
|
Pithon JA, Beaujouan V, Daniel H, Pain G, Vallet J. Are vineyards important habitats for birds at local or landscape scales? Basic Appl Ecol. 2016;17: 240–51.
|
|
R Core Team. R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2019.
|
|
Ralph CJ, Droege S, Sauer JR. Managing and monitoring birds using point counts: standards and applications. In: Ralph CJ, Droege S, Sauer JR, editors. Monitoring bird populations by point counts. Albany: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station; 1995. p. 161–8.
|
|
Rotenberry JT, Wiens JA. A synthetic approach to principal component analysis of bird/habitat relationships. In: Capen DE, editor. The use of multivariate statistics in studies of wildlife habitat. Fort-Collins: Rocky Mountain Forest and Range Experiment Station; 1981. p. 197–208.
|
| 1. | Leonardo Brustenga, Giulia Rigamonti, Iolanda Moretta, et al. The Spiky Side of Urban Wildlife, First Detection of a Zoonotic Assemblage of Giardia duodenalis in European Hedgehogs (Erinaceus europaeus) from Italy. Acta Parasitologica, 2025, 70(2) DOI:10.1007/s11686-025-01009-y |
| 2. | Simona Gabrielli, Leonardo Brustenga, Giulia Morganti, et al. Genetic variability of Dirofilaria repens isolates from humans and dogs in Italy. Veterinary Parasitology, 2024, 326: 110096. DOI:10.1016/j.vetpar.2023.110096 |
| 3. | Donato Traversa, Angela Di Cesare, Simone Morelli, et al. Hepatozoon spp. in stray cats from the metropolitan area of Rio de Janeiro, Brazil. Parasite, 2024, 31: 24. DOI:10.1051/parasite/2024026 |
| 4. | L. Brustenga, S. Massetti, C. Paletta, et al. Shaping young naturalists, owl pellets dissection to train high-school students in comparative anatomy and molecular biology. Journal of Biological Education, 2024. DOI:10.1080/00219266.2024.2386252 |
| 5. | Claudia Greco, Cristiano Tabarroni, Irene Pellegrino, et al. Combining Historical and Molecular Data to Study Nearly Extinct Native Italian Grey Partridge (Perdix perdix) at the Turn of the Twentieth Century. Biology, 2024, 13(9): 709. DOI:10.3390/biology13090709 |
| 6. | Diletta Santovito, Leonardo Brustenga, Livia Lucentini, et al. Negative Evidence for Sex-Linked Heteroplasmy in the Nemertean Worm Notospermus geniculatus (Delle Chiaje, 1822). Sustainability, 2023, 15(13): 10212. DOI:10.3390/su151310212 |
| 7. | Leonardo Brustenga, Paolo Viola, Pedro Girotti, et al. An Updated List of Rock Partridge (Alectoris graeca) Haplotypes from the Apennines—Central Italy. Data, 2022, 7(9): 124. DOI:10.3390/data7090124 |
| 8. | Kai Liu, Nan Xie, Heng-Jia Ma. Next-generation sequencing reveals the mitogenomic heteroplasmy in the topmouth culter (Culter alburnus Basilewsky, 1855). Molecular Biology Reports, 2022, 49(2): 943. DOI:10.1007/s11033-021-06913-w |
| 9. | Diego Fontaneto, Paolo Viola, Claudia Pizzirani, et al. Mismatches between Morphology and DNA in Italian Partridges May Not Be Explained Only by Recent Artificial Release of Farm-Reared Birds. Animals, 2022, 12(5): 541. DOI:10.3390/ani12050541 |
| 10. | Kemal Karabağ, Emel Tüten Sevim, Şadiye Taşbaş. Genetic Relationships Between Commercially Produced and Natural Populations of Bombus Terrestris Dalmatinus in Terms of Mitochondrial COI and CytB. Journal of Apicultural Science, 2021, 65(2): 315. DOI:10.2478/jas-2021-0025 |
Figures(3) / Tables(3)
DownLoad:
Email Alerts
RSS Feeds