Volume 11 Issue 1
Apr.  2020
Turn off MathJax
Article Contents
Abstract
Correspondence
Supplementary information
Acknowledgements
Authors' contributions
Availability of data and materials
Ethics approval and consent to participate
Consent for publication
Competing interests
References
Related Articles
Kevin A. Wood, Phoebe Ham, Jake Scales, Eleanor Wyeth, Paul E. Rose. 2020: Aggressive behavioural interactions between swans (Cygnus spp.) and other waterbirds during winter: a webcam-based study. Avian Research, 11(1): 30. DOI: 10.1186/s40657-020-00216-7
Citation: Kevin A. Wood, Phoebe Ham, Jake Scales, Eleanor Wyeth, Paul E. Rose. 2020: Aggressive behavioural interactions between swans (Cygnus spp.) and other waterbirds during winter: a webcam-based study. Avian Research, 11(1): 30. DOI: 10.1186/s40657-020-00216-7
shu

Aggressive behavioural interactions between swans (Cygnus spp.) and other waterbirds during winter: a webcam-based study

  • 1.

    Wildfowl & Wetlands Trust, Slimbridge Wetland Centre, Slimbridge, Gloucestershire GL2 7BT, UK

  • 2.

    Centre for Research in Animal Behaviour, Psychology, Washington Singer, University of Exeter, Perry Road, Exeter, Devon EX4 4QG, UK

  • 3.

    University Centre Sparsholt College, Sparsholt, Hampshire SO21 2NF, UK

More Information
  • Corresponding author:

    Paul E. Rose, p.rose@exeter.ac.uk

  • Received Date: 28 Jun 2020
  • Accepted Date: 01 Aug 2020
  • Available Online: 24 Apr 2022
  • Publish Date: 06 Aug 2020
    Graphical Abstract
    • Abstract
  • Background 

    Our understanding of any impacts of swans on other waterbirds (including other swans), and potential effects on waterbird community structure, remain limited by a paucity of fundamental behavioural and ecological data, including which species swans interact aggressively with and how frequently such interactions occur.

    Methods 

    Behavioural observations of aggression by swans and other waterbirds in winters 2018/2019 and 2019/2020, were carried out via live-streaming webcams at two wintering sites in the UK. All occurrence sampling was used to identify all aggressive interactions between conspecific or heterospecifics individuals, whilst focal observations were used to record the total time spent by swans on aggressive interactions with other swans. Binomial tests were then used to assess whether the proportion of intraspecific aggressive interactions of each species differed from 0.5 (which would indicate equal numbers of intraspecific and interspecific interactions). Zero-inflated generalized linear mixed effects models (ZIGLMMs) were used to assess between-individual variation in the total time spent by swans on aggressive interactions with other swans.

    Results 

    All three swan species were most frequently aggressive towards, and received most aggression from, their conspecifics. Our 10-min focal observations showed that Whooper (Cygnus cygnus) and Bewick's Swans (C. columbianus bewickii) spent 13.8± 4.7 s (means± 95% CI) and 1.4± 0.3 s, respectively, on aggression with other swans. These durations were equivalent to 2.3% and 0.2% of the Whooper and Bewick's Swan time-activity budgets, respectively. Model selection indicated that the time spent in aggressive interactions with other swans was best-explained by the number of other swans present for Whooper Swans, and an interactive effect of time of day and winter of observation for Bewick's Swans. However, the relationship between swan numbers and Whooper Swan aggression times was not strong (R2= 19.3%).

    Conclusions 

    Whilst swans do exhibit some aggression towards smaller waterbirds, the majority of aggression by swans is directed towards other swans. Aggression focused on conspecifics likely reflects greater overlap in resource use, and hence higher potential for competition, between individuals of the same species. Our study provides an example of how questions relating to avian behaviour can be addressed using methods of remote data collection such as live-streaming webcams.

    • FullText(HTML)

  • The Grey Partridge (Perdix perdix Linnaeus, 1758) is a polytypic Galliform species included in the Least Concern (LC) category of the IUCN Red List of Threatened Species at both global (Staneva and Burfield 2017) and national scale (Peronace et al. 2012). Considering that, to date, Grey Partridge's population genetics is based on mtDNA (Andersen and Kahlert 2012), and that heteroplasmy has been previously described specifically in hybrids and other Galliform species (Barr et al. 2005; Gandolfi et al. 2017), we decided to investigate the presence of this phenomenon in P. perdix.

    During this research, both wild and farm animals were analyzed (102 samples, Additional file 1); as concerns wild animals, both present and historical (see Gandolfi et al. 2017 for "historical" definition), P. perdix samples were characterized, whereas as to contemporary live samples, non-invasive specimens belonged both to husbandries or were sampled in nature (feather or faeces).

    DNA was extracted through a specifically modified protocol (Lucentini et al. 2010), and two mitochondrial genes, Cytochrome Oxidase Subunit I (COI) and Control Region (CR/D-loop), were amplified (Kerr et al. 2007; Barbanera et al. 2009) and Sanger sequencing was outsourced for both ends of amplicons to Eurofins Genomics.

    All sequences of 561 bp for D-loop and of 334 bp for COI were screened manually looking for double peaks in order to evaluate the presence and to validate point heteroplasmy (Ramos et al. 2013). We found out that, out of 102 individuals, nine showed point heteroplasmy in the D-loop fragment (Fig. 1A), and two in COI gene. Both mutations are missense, causing in the first case the substitution of an Isoleucine (AUU) by a Serine (AGU) while in the other case a Glycine (CAA) was substituted by an Arginine (CGA).

    Figure  1.  A Example of D-loop heteroplasmy in Perdix samples. Example of polymorphic site (b) (GenBank MN413492), clearly showing mtDNA heteroplasmy compared with homoplasmic samples for this site (a) (GenBank MN413497) (c) (GenBank MN413494). B Electropherogram of one of the cloned samples and of two related clones (MN413488–MN413489)
    DownLoad: Full-Size Img PowerPoint

    Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for D-loop and MN480303–MN480304, MT649229–MT649247 for COI).

    Specimens presenting clear heteroplasmic D-loop single mutation sites and others showing electropherograms suggesting D-loop heteroplasmy insertion/deletion, were cloned using pGEM-T Easy vector (Promega) following the manufacturer's instructions. The analysis of clones strongly confirms the presence of heteroplasmy and the absence of any contamination. In fact, obtained clones, when sequenced, showed two different haplotypes, confirming the presence of more than one mtDNA in each cloned sample (Fig. 1B).

    Furthermore, to rule out possible contaminations, 39 individuals, including the nine heteroplasmic ones, were genotyped with a nuclear gene, the Oocyte maturation factor (c-mos) using both primers appropriately designed for this purpose (CMOS2F; F5′-3′GCTGTGAAGCAAGTGAAGAA; CMOS2 R; R5′-3′AGCCGAAGTCTCCAATCTT) and those described by Shen et al. (2014). The analysis of this nuclear locus never showed any double peaks and/or signal superimposition, thus excluding the presence of sample contamination. Obtained related sequences were registered in GenBank (MN442418–MN442421).

    In conclusion, this study provides the first evidence of mitochondrial heteroplasmy in Perdix perdix, a phenomenon that can create some ambiguities in phylogenetic and evolutionary interpretations. In fact, paternal mtDNA could lead to inaccurate estimates of divergence times if the molecular clock is used, and could confuse the putative haplogroup assignment. Furthermore, the data obtained, suggesting the occurrence of hybridization in Perdix perdix, strongly underlined the importance of the rapid adoption of control measures aimed to prevent the introduction of genomes from different geographical areas and to avoid the concrete risk of an extinction vortex to which the residual, small and isolated populations are segregated.

    Further researches should focus to advance the knowledge on the hybridization scheme of Perdix species and on the possible interfertile species, to better understand the evolutionary history of the species and its management.

    Supplementary information accompanies this paper at https://doi.org/10.1186/s40657-020-00213-w.

    Authors would like to thank the Natural History Museum of the University of Pisa, the Civic Museum of Zoology of Rome, the Casalina's Gallery of Natural History and the Natural History Museum of Fisiocritici of Siena.

    AA, PV and LL conceived and designed the research. PV, PS and AA acquired samples. CP, FG and LL performed the sample analysis. LL, AF and AA analyzed the data. PV, LL, CP, FS, IDR and AA conducted manuscript preparation, revising and analysis of intellectual contents. LL and AA contributed equally to the extent of this research. All authors read and approved the final manuscript.

    Sample number and origin of each sample was reported. In particular a geographical origin or a museum/collection collocation was specified, if applicable. Furthermore, details about GenBank code on D-Loop, COI and c-mos fragment were provided. Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for Dloop, MN480303–MN480304, MT649229–MT649247 for COI and MN442418–MN442421 for c-mos).

    The performed sampling procedures and analyses are consistent with the Directive 2010/63/EU, the Italian national regulations and the indications of the Ethics Committee of the Universities of Perugia and Viterbo (Italy). The approval by the Ethics Committee was not necessary because of the nature of the samples (museal individuals) and of the non-invasive in vivo sampling method. In fact, just two feathers were collected from live animals excluding those having a functional role. Birds were immediately released at the same sampling site. The sampling campaign was authorized by local authorities with the scientific ISPRA authorization number 12184.

    Not applicable.

    The authors declare that they have no competing interests.

    • References (68)
  • Altmann J. Observational study of behavior: sampling methods. Behaviour. 1974;49:227–66.
    Amat JA. Food usurpation by waterfowl and waders. Wildfowl. 1990;41:107–16.
    Anderson MJ, Urbine JL, Wilson C, Callabro L. Employment of web-based images and a live web cam in the examination of lateral neck-resting preferences in the American flamingo (Phoenicopterus ruber). J Caribb Ornithol. 2011;24:41–7.
    Arnold TW. Uninformative parameters and model selection using Akaike's Information Criterion. J Wildl Manage. 2010;74:1175–8.
    Bailey RO, Batt BDJ. Hierarchy of waterfowl feeding with Whistling Swans. Auk. 1974;91:488–93.
    Barton K. MuMIn: Multi-Model Inference. Version 1.43.15. 2019. .
    Beekman J, Koffijberg K, Wahl J, Kowallik C, Hall C, Devos K, et al. Long-term population trends and shifts in distribution for Bewick's Swans Cygnus columbianus bewickii wintering in northwest Europe. Wildfowl. 2019; Special Issue 5: 73–102.
    Beven G. Coot feeding on weed disturbed by Mute Swans. Brit Birds. 1980;73:219–20.
    Black JM, Rees EC. The structure and behaviour of the Whooper Swan population wintering at Caerlaverock, Dumfries and Galloway, Scotland: an introductory study. Wildfowl. 1984;35:21–36.
    Bowler JM. Feeding strategies of Bewick's Swans (Cygnus columbianus bewickii) in winter. PhD Thesis. Bristol: University of Bristol; 1996.
    Brazil MA. A case of unusual aggression by a Whooper Swan. Tori. 1983;32:155.
    Brides K, Wood KA, Hearn RD, Fijen TPM. Changes in the sex ratio of the Common Pochard Aythya ferina in Europe and North Africa. Wildfowl. 2017;67:100–12.
    Brooks ME, Kristensen K, van Benthem KJ, Magnusson A, Berg CW, Nielsen A, et al. glmmTMB balances speed and flexibility among packages for zeroinflated generalized linear mixed modeling. R J. 2017;9:378–400.
    Burgess RM, Stickney AA. Interspecific aggression by Tundra Swans towards Snow Geese on the Sagavanirktok River Delta, Alaska. Auk. 1994;111:204–7.
    Burnham KP, Anderson DR, Huyvaert KP. AIC model selection and multimodel inference in behavioral ecology: some background, observations, and comparisons. Behav Ecol Sociobiol. 2011;65:23–35.
    Clopper CJ, Pearson ES. The use of confidence or fiducial limits illustrated in the case of the binomial. Biometrika. 1934;26:404–13.
    Conover MR, Kania GS. Impact of interspecific aggression and herbivory by mute swans on native waterfowl and aquatic vegetation in New England. Auk. 1994;111:744–8.
    Crawley MJ. The R Book. 2nd ed Chichester: Wiley; 2013.
    Davis JB, Guillemain M, Kaminski RM, Arzel C, Eadie JM, Rees EC. Habitat and resource use by waterfowl in the northern hemisphere in autumn and winter. Wildfowl. 2014;4:17–69.
    Delacour J. Waterfowl in large mixed collections. Int Zoo Yearb. 1973;13:15–9.
    Dormann CF, Elith J, Bacher S, Buchmann C, Carl G, Carré G, et al. Collinearity: a review of methods to deal with it and a simulation study evaluating their performance. Ecography. 2013;36:27–46.
    Eichorst B. Internet webcams provide opportunities for college student research on animal behavior and ecology: an example with birds. Am Biol Teacher. 2018;80:680–5.
    Ely CR, Budeau DA, Swain UG. Aggressive encounters between Tundra Swans and Greater White-fronted Geese during brood rearing. Condor. 1987;89:420–2.
    Frost TM, Calbrade NA, Birtles GA, Mellan HJ, Hall C, Robinson AE, et al. Waterbirds in the UK 2018/2019: The Wetland Bird Survey. Thetford: BTO/RSPB/ JNCC; 2020.
    Gayet G, Guillemain M, Mesléard F, Fritz H, Vaux V, Broyer J. Are Mute Swans (Cygnus olor) really limiting fishpond use by waterbirds in the Dombes, Eastern France? J Ornithol. 2011;152:45–53.
    Gayet G, Calenge C, Broyer J, Mesléard F, Vaux V, Fritz H, et al. Analysis of spatial point pattern shows no desertion of breeding Mute Swan areas by the other waterbirds within fishpond. Acta Ornithol. 2016;5:151–63.
    Gillham ME. Feeding habits and seasonal movements of mute swans on two south Devon estuaries. Bird Study. 1956;3:205–12.
    Gurtovaya EN. Aggressive interactions between Bewick's Swans and other Anseriformes in the breeding period. Casarca. 2000;6:167–76.
    Gyimesi A, Stillman RA, Nolet BA. Cryptic interference competition in swans foraging on cryptic prey. Anim Behav. 2010;80:791–7.
    Gyimesi A, van Lith B, Nolet BA. Commensal foraging with Bewick's Swans Cygnus bewickii doubles instantaneous intake rate of Common Pochard Aythya ferina. Ardea. 2012;100:55–62.
    Holm S. A simple sequentially rejective multiple test procedure. Scand J Stat. 1979;6:65–70.
    Johnsgard PA. Handbook of waterfowl behavior. New York: Cornell University Press; 1965.
    Källander H. Commensal association of waterfowl with feeding swans. Waterbirds. 2005;28:326–31.
    King JA. The ecology of aggressive behavior. Annu Rev Ecol Syst. 1973;4:117–38.
    Lenth R. Emmeans: Estimated Marginal Means, aka Least-Squares Means. Version 1.4.5. 2020. .
    Lind H. The rotation display of the Mute Swan Cygnus olor: synchronised neighbour responses as instrument in the territorial defence strategy. Ornis Scand. 1984;15:98–104.
    Lüdecke D. Sjstats: Statistical Functions for Regression Models. Version 0.17.9. 2020. .
    Lumsden HG. Trumpeter Swans and Mute Swans compete for space in Ontario. Ontario Birds. 2016;34:14–23.
    Mac Nally R, Duncan RP, Thomson JR, Yen JD. Model selection using information criteria, but is the "best" model any good? J Appl Ecol. 2018;55:1441–4.
    Marchowski D, Neubauer G. Kleptoparasitic strategies of Mallards towards conspecifics and Eurasian Coots. Ardea. 2019;107:110–4.
    Metcalfe NB, Furness RW. Aggression in shorebirds in relation to flock density and composition. Ibis. 1987;129:553–63.
    Nakagawa S, Johnson PC, Schielzeth H. The coefficient of determination R2 and intra-class correlation coefficient from generalized linear mixedeffects models revisited and expanded. J R Soc Int. 2017;14:20170213.
    Newth JL, McDonald RA, Wood KA, Rees EC, Semenov I, Chistyakov A, et al. Predicting intention to hunt protected wildlife: a case study of Bewick's swans in the European Russian Arctic. Oryx. (in press).
    O'Hare MT, Stillman RA, McDonnell JO, Wood LR. Effects of mute swan grazing on a keystone macrophyte. Freshwater Biol. 2007;52:2463–75.
    Peiman K, Robinson B. Ecology and evolution of resource-related heterospecific aggression. Quart Rev Biol. 2010;85:133–58.
    Pelligrini AD. The roles of aggressive and affiliative behaviors in resource control: a behavioral ecological perspective. Dev Rev. 2008;28:461–87.
    Peluso AI, Royer EA, Wall MJ, Anderson MJ. The relationship between environmental factors and flamingo aggression examined with internet resources. Avian Biol Res. 2013;6:215–20.
    Pöysä H. Resource utilization pattern and guild structure in a waterfowl community. Oikos. 1983;40:295–307.
    R Core Team. R: A language and environment for statistical computing. [3.6.3]. Vienna, Austria: R Foundation for Statistical Computing; 2020.
    Rees EC. Bewick's Swan. London: T & AD Poyser; 2006.
    Rees EC, Cao L, Clausen P, Coleman JT, Cornely J, Einarsson O, et al. Conservation status of the world's swan populations, Cygnus sp. and Coscoroba sp.: a review of current trends and gaps in knowledge. Wildfowl. 2019; Special Issue 5: 35–72.
    Richards SA. Dealing with overdispersed count data in applied ecology. J Appl Ecol. 2008;45:218–27.
    RSPB. Birds A- Z: Bird Guides. Royal Society for the Protection of Birds. . Accessed October 2018.
    Schulwitz SE, Spurling DP, Davis TS, McClure CJW. Webcams as an untapped opportunity to conduct citizen science: siz years of the American Kestrel Partnership's KestrelCam. Glob Ecol Conserv. 2018;15:e00434.
    Scott DK. Social behaviour of wintering Cygnus columbianus bewickii. In: Matthews GVT, Smart M, editors. Proceedings of the Second International IWRB Swan Symposium, Sapporo, Japan, 1980. Slimbridge: International Waterfowl Research Bureau; 1981. p. 211–25.
    Shimada T. Ducks foraging on swan faeces. Wildfowl. 2012;62:224–7.
    Sladen WJL. Swans should not be hunted. In: Sears J, Bacon PJ, editors. Proceedings of the Third International IWRB Swan Symposium, Oxford, 1989. Slimbridge: International Waterfowl Research Bureau; 1991. p. 368–75.
    Stone WB, Marsters AD. Aggression among captive Mute Swans. New York Fish Game J. 1970;17:51–3.
    Tatu KS, Anderson JT, Hindman LJ, Seidel G. Diurnal foraging activities of mute swans in Chesapeake Bay, Maryland. Waterbirds. 2007;30:121–9.
    Therres GD, Brinkler DF. Mute Swan interactions with other birds in Chesapeake Bay. In: Perry MC, editor. Mute Swans and Their Chesapeake Bay Habitats: Proceedings of a Symposium. Virginia: US Geological Survey; 2004. p. 43–6.
    Tingay A. Aggression in the Black Swan. Emu. 1974;74:35–8.
    Vogrin M. A Coot Fulica atra eating waterfowl droppings. Butll GCA. 1997;14:63–4.
    Włodarczyk R, Minias P. Division of parental duties confirms a need for biparental care in a precocial bird, the mute swan Cygnus olor. Anim Biol. 2015;65:163–76.
    Wood KA, Stillman RA, Goss-Custard JD. The effect of kleptoparasite and host numbers on the risk of food-stealing in an avian assemblage. J Avian Biol. 2015;46:589–96.
    Wood KA, Ponting J, D'Costa N, Newth JL, Rose PE, Glazov P, et al. Understanding intrinsic and extrinsic drivers of aggressive behaviour in waterbird assemblages: a meta-analysis. Anim Behav. 2017;126:209–16.
    Wood KA, Cao L, Clausen P, Ely CR, Luigujõe L, Rees EC, et al. Current trends and future directions in swan research: insights from the 6th International Swan Symposium. Wildfowl. 2019a; Special Issue 5:1–34.
    Wood KA, Hilton GM, Newth JL, Rees EC. Seasonal variation in energy gain explains patterns of resource use by avian herbivores in an agricultural landscape: insights from a mechanistic model. Ecol Model. 2019b;409:108762.
    Zuur AF, Ieno EN, Elphick CS. A protocol for data exploration to avoid common statistical problems. Methods Ecol Evol. 2010;1:3–14.
    • Related Articles

  • Related Articles

    Monika Homolková, Petr Musil, Diego Pavón-Jordán, Dorota Gajdošová, Zuzana Musilová, Šárka Neužilová, Jan Zouhar. 2024: Changes in the adult sex ratio of six duck species breeding populations over two decades. Avian Research, 15(1): 100187. DOI: 10.1016/j.avrs.2024.100187
    Ji-Yeon Lee, Hyung-Kyu Nam, Jin-Young Park, Seung-Gu Kang, Nyambayar Batbayar, Dong-Won Kim, Jae-Woong Hwang, Otgonbayar Tsend, Tseveenmyadag Natsagdorj, Jugdernamjil Nergui, Tuvshintugs Sukhbaatar, Wee-Haeng Hur, Jeong-Chil Yoo. 2023: Migration routes and differences in migration strategies of Whooper Swans between spring and autumn. Avian Research, 14(1): 100113. DOI: 10.1016/j.avrs.2023.100113
    Iderbat Damba, Junjian Zhang, Kunpeng Yi, Huashan Dou, Nyambayar Batbayar, Tseveenmyadag Natsagdorj, Batmunkh Davaasuren, Lei Cao, Anthony David Fox. 2021: Seasonal and regional differences in migration patterns and conservation status of Swan Geese (Anser cygnoides) in the East Asian Flyway. Avian Research, 12(1): 73. DOI: 10.1186/s40657-021-00308-y
    Kevin A. Wood, Kane Brides, Maurice E. Durham, Richard D. Hearn. 2021: Adults have more male-biased sex ratios than first-winter juveniles in wintering duck populations. Avian Research, 12(1): 51. DOI: 10.1186/s40657-021-00286-1
    Kevin A. Wood, Julia L. Newth, Geoff M. Hilton, Eileen C. Rees. 2021: Behavioural and energetic consequences of competition among three overwintering swan (Cygnus spp.) species. Avian Research, 12(1): 48. DOI: 10.1186/s40657-021-00282-5
    Yan Chen, Yong Zhang, Lei Cao, Willem F. de Boer, Anthony D. Fox. 2019: Wintering Swan Geese maximize energy intake through substrate foraging depth when feeding on buried Vallisneria natans tubers. Avian Research, 10(1): 6. DOI: 10.1186/s40657-019-0145-x
    Diann J. Prosser, Changqing Ding, R. Michael Erwin, Taej Mundkur, Jeffery D. Sullivan, Erle C. Ellis. 2018: Species distribution modeling in regions of high need and limited data: waterfowl of China. Avian Research, 9(1): 7. DOI: 10.1186/s40657-018-0099-4
    An An, Yong Zhang, Lei Cao, Qiang Jia, Xin Wang. 2018: A potential distribution map of wintering Swan Goose (Anser cygnoides) in the middle and lower Yangtze River floodplain, China. Avian Research, 9(1): 43. DOI: 10.1186/s40657-018-0134-5
    Andrew J. Hamilton, Chloé Conort, Aurore Bueno, Christopher G. Murray, James R. Grove. 2017: Waterbird use of farm dams in south-eastern Australia: abundance and influence of biophysical and landscape characteristics. Avian Research, 8(1): 2. DOI: 10.1186/s40657-016-0058-x
    Bruce E. LYON, John M. EADIE. 2013: Patterns of host use by a precocial obligate brood parasite, the Black-headed Duck: ecological and evolutionary considerations. Avian Research, 4(1): 71-85. DOI: 10.5122/cbirds.2013.0008

  • Cited by

    Periodical cited type(10)

    1. Leonardo Brustenga, Giulia Rigamonti, Iolanda Moretta, et al. The Spiky Side of Urban Wildlife, First Detection of a Zoonotic Assemblage of Giardia duodenalis in European Hedgehogs (Erinaceus europaeus) from Italy. Acta Parasitologica, 2025, 70(2) DOI:10.1007/s11686-025-01009-y
    2. Simona Gabrielli, Leonardo Brustenga, Giulia Morganti, et al. Genetic variability of Dirofilaria repens isolates from humans and dogs in Italy. Veterinary Parasitology, 2024, 326: 110096. DOI:10.1016/j.vetpar.2023.110096
    3. Donato Traversa, Angela Di Cesare, Simone Morelli, et al. Hepatozoon spp. in stray cats from the metropolitan area of Rio de Janeiro, Brazil. Parasite, 2024, 31: 24. DOI:10.1051/parasite/2024026
    4. L. Brustenga, S. Massetti, C. Paletta, et al. Shaping young naturalists, owl pellets dissection to train high-school students in comparative anatomy and molecular biology. Journal of Biological Education, 2024. DOI:10.1080/00219266.2024.2386252
    5. Claudia Greco, Cristiano Tabarroni, Irene Pellegrino, et al. Combining Historical and Molecular Data to Study Nearly Extinct Native Italian Grey Partridge (Perdix perdix) at the Turn of the Twentieth Century. Biology, 2024, 13(9): 709. DOI:10.3390/biology13090709
    6. Diletta Santovito, Leonardo Brustenga, Livia Lucentini, et al. Negative Evidence for Sex-Linked Heteroplasmy in the Nemertean Worm Notospermus geniculatus (Delle Chiaje, 1822). Sustainability, 2023, 15(13): 10212. DOI:10.3390/su151310212
    7. Leonardo Brustenga, Paolo Viola, Pedro Girotti, et al. An Updated List of Rock Partridge (Alectoris graeca) Haplotypes from the Apennines—Central Italy. Data, 2022, 7(9): 124. DOI:10.3390/data7090124
    8. Kai Liu, Nan Xie, Heng-Jia Ma. Next-generation sequencing reveals the mitogenomic heteroplasmy in the topmouth culter (Culter alburnus Basilewsky, 1855). Molecular Biology Reports, 2022, 49(2): 943. DOI:10.1007/s11033-021-06913-w
    9. Diego Fontaneto, Paolo Viola, Claudia Pizzirani, et al. Mismatches between Morphology and DNA in Italian Partridges May Not Be Explained Only by Recent Artificial Release of Farm-Reared Birds. Animals, 2022, 12(5): 541. DOI:10.3390/ani12050541
    10. Kemal Karabağ, Emel Tüten Sevim, Şadiye Taşbaş. Genetic Relationships Between Commercially Produced and Natural Populations of Bombus Terrestris Dalmatinus in Terms of Mitochondrial COI and CytB. Journal of Apicultural Science, 2021, 65(2): 315. DOI:10.2478/jas-2021-0025

    Other cited types(0)

Catalog

    Figures(3)  /  Tables(6)

    Get Citation
    PDF
    XML

    Article Metrics

    Article has an altmetric score of 757
    Article has an altmetric score of 757
    Article views (1106) PDF downloads (8) Cited by(10)
    Supported by: Beijing Renhe Information Technology Co. Ltd.   Technical support: info@rhhz.net

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return