| Citation: |
Ines G. Moran, Katrina C. Lukianchuk, Stéphanie. M. Doucet, Amy E. M. Newma, Heather Williams, D. Ryan Norris, Daniel J. Mennill. 2019: Diel and seasonal patterns of variation in the singing behaviour of Savannah Sparrows (Passerculus sandwichensis). Avian Research, 10(1): 26. DOI: 10.1186/s40657-019-0165-6
|
The vocalizations of birds are dynamic traits that often vary in output with time of day and time of year. By quantifying patterns of diel and seasonal variation in vocal output, we can gain insight into the ecology and evolution of birds and the function of their vocalizations. In this investigation, we quantified diel and seasonal variation in song output by studying a breeding population of Savannah Sparrows (Passerculus sandwichensis).
We used autonomous recorders to collect extensive recordings across the breeding season in a long-term, colour-marked study population of Savannah Sparrows in eastern Canada. We described diel and seasonal variation across five different breeding stages based on recordings of more than 50, 000 songs from 34 males.
During the pre-breeding stage, prior to female arrival, males sang a pronounced dawn chorus with a peak in song output during the early morning. During the breeding stage, in contrast, the dawn chorus was diminished and males instead exhibited a pronounced dusk chorus with a peak in song output during the evening. Across the breeding season, the highest levels of song output occurred in late April and early May, soon after males arrived on the breeding grounds, and the lowest levels occurred in August, prior to the departure of birds for the wintering grounds.
These patterns suggest that Savannah Sparrows' early-season dawn choruses are directed at males and serve a territorial defense function. Later-season dusk choruses, in contrast, appear to play a role in attracting mates and possibly acoustic mate guarding.
The Grey Partridge (Perdix perdix Linnaeus, 1758) is a polytypic Galliform species included in the Least Concern (LC) category of the IUCN Red List of Threatened Species at both global (Staneva and Burfield 2017) and national scale (Peronace et al. 2012). Considering that, to date, Grey Partridge's population genetics is based on mtDNA (Andersen and Kahlert 2012), and that heteroplasmy has been previously described specifically in hybrids and other Galliform species (Barr et al. 2005; Gandolfi et al. 2017), we decided to investigate the presence of this phenomenon in P. perdix.
During this research, both wild and farm animals were analyzed (102 samples, Additional file 1); as concerns wild animals, both present and historical (see Gandolfi et al. 2017 for "historical" definition), P. perdix samples were characterized, whereas as to contemporary live samples, non-invasive specimens belonged both to husbandries or were sampled in nature (feather or faeces).
DNA was extracted through a specifically modified protocol (Lucentini et al. 2010), and two mitochondrial genes, Cytochrome Oxidase Subunit I (COI) and Control Region (CR/D-loop), were amplified (Kerr et al. 2007; Barbanera et al. 2009) and Sanger sequencing was outsourced for both ends of amplicons to Eurofins Genomics.
All sequences of 561 bp for D-loop and of 334 bp for COI were screened manually looking for double peaks in order to evaluate the presence and to validate point heteroplasmy (Ramos et al. 2013). We found out that, out of 102 individuals, nine showed point heteroplasmy in the D-loop fragment (Fig. 1A), and two in COI gene. Both mutations are missense, causing in the first case the substitution of an Isoleucine (AUU) by a Serine (AGU) while in the other case a Glycine (CAA) was substituted by an Arginine (CGA).
Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for D-loop and MN480303–MN480304, MT649229–MT649247 for COI).
Specimens presenting clear heteroplasmic D-loop single mutation sites and others showing electropherograms suggesting D-loop heteroplasmy insertion/deletion, were cloned using pGEM-T Easy vector (Promega) following the manufacturer's instructions. The analysis of clones strongly confirms the presence of heteroplasmy and the absence of any contamination. In fact, obtained clones, when sequenced, showed two different haplotypes, confirming the presence of more than one mtDNA in each cloned sample (Fig. 1B).
Furthermore, to rule out possible contaminations, 39 individuals, including the nine heteroplasmic ones, were genotyped with a nuclear gene, the Oocyte maturation factor (c-mos) using both primers appropriately designed for this purpose (CMOS2F; F5′-3′GCTGTGAAGCAAGTGAAGAA; CMOS2 R; R5′-3′AGCCGAAGTCTCCAATCTT) and those described by Shen et al. (2014). The analysis of this nuclear locus never showed any double peaks and/or signal superimposition, thus excluding the presence of sample contamination. Obtained related sequences were registered in GenBank (MN442418–MN442421).
In conclusion, this study provides the first evidence of mitochondrial heteroplasmy in Perdix perdix, a phenomenon that can create some ambiguities in phylogenetic and evolutionary interpretations. In fact, paternal mtDNA could lead to inaccurate estimates of divergence times if the molecular clock is used, and could confuse the putative haplogroup assignment. Furthermore, the data obtained, suggesting the occurrence of hybridization in Perdix perdix, strongly underlined the importance of the rapid adoption of control measures aimed to prevent the introduction of genomes from different geographical areas and to avoid the concrete risk of an extinction vortex to which the residual, small and isolated populations are segregated.
Further researches should focus to advance the knowledge on the hybridization scheme of Perdix species and on the possible interfertile species, to better understand the evolutionary history of the species and its management.
Supplementary information accompanies this paper at https://doi.org/10.1186/s40657-020-00213-w.
Authors would like to thank the Natural History Museum of the University of Pisa, the Civic Museum of Zoology of Rome, the Casalina's Gallery of Natural History and the Natural History Museum of Fisiocritici of Siena.
AA, PV and LL conceived and designed the research. PV, PS and AA acquired samples. CP, FG and LL performed the sample analysis. LL, AF and AA analyzed the data. PV, LL, CP, FS, IDR and AA conducted manuscript preparation, revising and analysis of intellectual contents. LL and AA contributed equally to the extent of this research. All authors read and approved the final manuscript.
Sample number and origin of each sample was reported. In particular a geographical origin or a museum/collection collocation was specified, if applicable. Furthermore, details about GenBank code on D-Loop, COI and c-mos fragment were provided. Different haplotypes were retrieved and deposited in GenBank (Accession Numbers MN413488–MN413500, MT649222–MT649228 for Dloop, MN480303–MN480304, MT649229–MT649247 for COI and MN442418–MN442421 for c-mos).
The performed sampling procedures and analyses are consistent with the Directive 2010/63/EU, the Italian national regulations and the indications of the Ethics Committee of the Universities of Perugia and Viterbo (Italy). The approval by the Ethics Committee was not necessary because of the nature of the samples (museal individuals) and of the non-invasive in vivo sampling method. In fact, just two feathers were collected from live animals excluding those having a functional role. Birds were immediately released at the same sampling site. The sampling campaign was authorized by local authorities with the scientific ISPRA authorization number 12184.
Not applicable.
The authors declare that they have no competing interests.
|
Bédard J, LaPointe G. Banding returns, arrival times, and site fidelity in the Savannah Sparrow. Wilson Bull. 1984;96:196-205.
|
|
Burt JM, Vehrencamp SL. Dawn chorus as an interactive communication network. In: McGregor P, editor. Animal communication networks. Cambridge: Cambridge University Press; 2005. p. 320-43.
|
|
Johnson LS, Kermott LH. The functions of song in male House Wrends Troglodytes aedon. Behaviour. 1991;166:190-209.
|
|
Poesel A, Dabelsteen T, Darden S-K, Delhey K, Peters A. Territorial responses of male blue tits, Cyanistes caeruleus, to UV-manipulated neighbours. J Ornithol. 2006;148:179-87.
|
|
Potter PE. Territorial behavior in Savannah Sparrows in southeastern Michigan. Wilson Bull. 1972;84:48-59.
|
|
Staicer CA, Spector DA, Horn AG. The dawn chorus and other diel patterns in acoustic signalling. In: Kroodsma DE, Miller EH, editors. Ecology and evolution of acoustic communication in birds. New York: Cornell University Press; 1996. p. 426-53.
|
|
Stafford KM, Nieukirk SL, Fox CG. Geographic and seasonal variation of blue whale calls in the North Pacific. J Cetacean Res Manag. 2001;3:65-76.
|
|
Tufts RW. Birds of Nova Scotia. 3rd ed. Halifax: Nimbus Publ. Ltd. and Nova Scotia Mus; 1986.
|
|
Wheelwright N, Rising J. Savannah Sparrow Passerculus sandwichensis. The birds of North America, vol. 45. New York: Cornell University Press; 2008.
|
| 1. | Jamie M. Douglas, Joanne Paul-Murphy, Elizabeth Stelow, et al. Personality Characteristics Predictive of Social Pairing Outcome in Orange-Winged Amazon Parrots ( Amazona amazonica ). Journal of Applied Animal Welfare Science, 2024, 27(2): 386. DOI:10.1080/10888705.2023.2268522 |
| 2. | Ossi Nokelainen, Patrik Lauha, Sebastian Andrejeff, et al. A Mobile Application–Based Citizen Science Product to Compile Bird Observations. Citizen Science: Theory and Practice, 2024, 9(1) DOI:10.5334/cstp.710 |
| 3. | Felix Noel Estrada Piñero, Fernando Urbina, Alejandro A. Ríos-Chelén, et al. Vocal characterization of the Streak-backed Oriole (Icterus pustulatus) in Morelos, Mexico, using recordings from sound collections. The Wilson Journal of Ornithology, 2024, 136(1) DOI:10.1676/22-00104 |
| 4. | Sarah L. Dobney, Mikayla M.K. Bornais, D. Ryan Norris, et al. Quiet in the nest: The nest environment attenuates song in a grassland songbird. Avian Research, 2023, 14: 100148. DOI:10.1016/j.avrs.2023.100148 |
| 5. | Shauni E. T. Omond, John A. Lesku. Persistence of Nocturnality in Decapitated and Bisected Flatworms. Journal of Biological Rhythms, 2023, 38(3): 269. DOI:10.1177/07487304231158947 |
| 6. | Miguel A. Mejías, David R. Wilson. The relationships of breeding stage to daytime singing behaviour and song perch height in Bermuda white‐eyed vireos Vireo griseus bermudianus. Journal of Avian Biology, 2023, 2023(7-8) DOI:10.1111/jav.03116 |
| 7. | Lotte Schlicht, Emmi Schlicht, Peter Santema, et al. A dawn and dusk chorus will emerge if males sing in the absence of their mate. Proceedings of the Royal Society B: Biological Sciences, 2023, 290(2011) DOI:10.1098/rspb.2023.2266 |
| 8. | Kaitlyn Plastino, Kevin C. Hannah, Rich Russell, et al. Hitting all the notes: Connecticut warblers sing an extended song type. Journal of Ornithology, 2022, 163(4): 953. DOI:10.1007/s10336-022-02005-z |
| 9. | Juliana Rodríguez-Fuentes, Carlos Daniel Cadena, Jorge Enrique Avendaño. Vocal behavior and microgeographic variation in song types in a Neotropical songbird. Journal of Ornithology, 2022, 163(1): 105. DOI:10.1007/s10336-021-01930-9 |
| 10. | Abby L J Hensel, Sarah L Dobney, Ines G Moran, et al. Passive acoustic monitoring provides predictable and reliable underestimates of population size and longevity in wild Savannah Sparrows. Ornithological Applications, 2022, 124(3) DOI:10.1093/ornithapp/duac018 |
| 11. | Sanja Barišić, Davor Ćiković, Vesna Tutiš, et al. Context dependent song-flight performance and timing in the Black-headed Bunting (Emberiza melanocephala). Avian Research, 2022, 13: 100059. DOI:10.1016/j.avrs.2022.100059 |
| 12. | Abby L.J. Hensel, Sarah L. Dobney, Stéphanie M. Doucet, et al. Microgeographical variation in birdsong: Savannah sparrows exhibit microdialects in an island population. Animal Behaviour, 2022, 188: 119. DOI:10.1016/j.anbehav.2022.04.008 |
| 13. | Parker Rundstrom, Nicole Creanza. Song learning and plasticity in songbirds. Current Opinion in Neurobiology, 2021, 67: 228. DOI:10.1016/j.conb.2021.02.003 |
| 14. | Michał Budka, Patryk Kokociński. Daily and seasonal changes of vocal activity of the Common Crane Grus grus: implications for conservation and monitoring efforts. Bird Study, 2021, 68(3): 311. DOI:10.1080/00063657.2022.2032590 |
| 15. | Johann H van Niekerk, Giovanni Forcina. Purpose of Crested FrancolinOrtygornis sephaenamale collective calls at dusk based on livestream audio censusing. Ostrich, 2020, 91(4): 326. DOI:10.2989/00306525.2020.1827463 |
| 16. | Mohammad Fahmy, David R. Wilson. Singing behaviour of ruby‐crowned kinglets Regulus calendula in relation to time‐of‐day, time‐of‐year and social context. Journal of Avian Biology, 2020, 51(7) DOI:10.1111/jav.02467 |
| 17. | Megan J. Thompson, Kendriah A. Pearse, Jennifer R. Foote, et al. Seasonal and diel plasticity of song type use in individual ovenbirds (Seiurus aurocapilla). Ethology, 2020, 126(8): 824. DOI:10.1111/eth.13040 |
| 18. | Daniel J. Mennill, Stéphanie M. Doucet, Amy E.M. Newman, et al. Eavesdropping on adult vocal interactions does not enhance juvenile song learning: an experiment with wild songbirds. Animal Behaviour, 2019, 155: 67. DOI:10.1016/j.anbehav.2019.05.019 |
Figures(4)
DownLoad:
Email Alerts
RSS Feeds