Djamel Bensizerara, Haroun Chenchouni. 2019: Are diurnal time-budgets and activity patterns density-dependent in the Shelduck (Tadorna tadorna) wintering in Algeria? An analysis across multiple temporal scales. Avian Research, 10(1): 12. DOI: 10.1186/s40657-019-0152-y
Citation: Djamel Bensizerara, Haroun Chenchouni. 2019: Are diurnal time-budgets and activity patterns density-dependent in the Shelduck (Tadorna tadorna) wintering in Algeria? An analysis across multiple temporal scales. Avian Research, 10(1): 12. DOI: 10.1186/s40657-019-0152-y

Are diurnal time-budgets and activity patterns density-dependent in the Shelduck (Tadorna tadorna) wintering in Algeria? An analysis across multiple temporal scales

More Information
  • Corresponding author:

    Haroun Chenchouni, chenchouni@gmail.com

  • Received Date: 17 Aug 2018
  • Accepted Date: 10 Apr 2019
  • Available Online: 24 Apr 2022
  • Publish Date: 15 Apr 2019
  • Background 

    The Shelduck (Tadorna tadorna) is a characteristic waterbird species of inland wetlands in northeastern Algeria. Its wintering behavior in relation to changes of local abundances and foraging group density is poorly known.

    Objectives 

    This study aims at monitoring patterns of diurnal activities and the variation of behavioral time-budgets in relation to numbers of wintering Shelducks. We investigate temporal variations of diurnal activities across multiple-time scales and consider their interrelationships.

    Methods 

    Assessments of local population abundance were weekly surveyed during two wintering seasons (2010-2012), whereas diurnal activities (feeding, sleeping, swimming, preening, loafing, flying, courtship, and antagonism) were studied three times a month during seven hours (08:00-16:00) using the Scan method. Time budget variations of each behavioral activity were tested using nested ANOVAs following multiple time scales. Generalized linear mixed-effects models (GLMM) tested whether variations in diurnal activities were density-dependent.

    Results 

    During the wintering season, Shelduck's numbers followed a bell-shaped trend, which indicated that the species was typically a wintering migrant in Sabkha Djendli. The first individuals arrived onsite in October-November then numbers reached a peak in January (up to 2400 individuals in 2012) with steady density during December-February, afterward individuals left the site progressively until late April when the site is deserted. During both wintering seasons, diurnal activities were dominated by feeding (60%), followed by sleeping (12%) then swimming and preening with 9% and 8%, respectively. The rest of the activities (loafing, flying, courtship and antagonistic behaviors) had low proportions of time budget. ANOVAs showed that activity time budgets varied significantly following multiple time scales (year, season, month, day, semi-hour). Time budgets of diurnal activities during each wintering season were significantly interrelated. Correlations patterns between the two seasons were similar. GLMMs revealed that the variations of diurnal activities were not density-dependent, except for preening and swimming.

    Conclusion 

    During the wintering season, habitats of Sabkha Djendli are important for waterbirds, including the Shelduck that used the lake mainly for food-foraging and resting. The 2400 individuals censused in mid-winter are important locally and at the North African scale. This stresses the need to strengthen the protection status of this wetland and mitigate degradation sources that threaten wintering waterfowl.

  • Microsatellites are also known as simple sequence repeats (SSRs), and are a few nucleotide sequence repeats distributed randomly in eukaryotic genomes. SSR markers are important tools to assess genetic diversity in avian because of their high level of polymorphism and codominant Mendelian inheritance (e.g. Randi et al., 2003). The Chinese Bamboo Partridge (Bambusicola thoracica) is an endemic gamebird that used to be widely distributed in temperate and subtropical forests of central and southeast China (Cheng, 1978; Johnsgard, 1999). At present, many studies have been conducted on the reproduction, habitat, anatomy and taxonomy of this bird (Chang et al., 1998; Lei and Lu, 2006; Huang et al., 2008; Yao et al., 2008). However, there are no molecular markers, such as SSRs isolated and applied in this species to date in spite of many molecular markers that have been developed and used broadly in other gamebirds (He et al., 2009; Wang et al., 2009; Zhou and Zhang, 2009). The lack of sufficient and polymorphic SSR markers limits research in genetic diversity for conservation purpose of this species. Thus, screening for polymorphic microsatellite markers in the Chinese Bamboo Partridge is very important and necessary for analyzing genome organization and evolution and developing marker-assisted breeding technology. In this study, we obtained ten polymorphic microsatellite loci for this partridge from its relative species, Gallus gallus, through cross-species amplification.

    In order to characterize isolated microsatellite markers, twenty samples of Chinese Bamboo Partridge were collected from Jinggangshan (26°22′N, 114°05′E), Jiangxi Province in China during two consecutive hunting seasons (2007 and 2008). Liver/muscle samples were dissected from birds and stored in 100% ethanol immediately after removal. Genomic DNA was extracted from livers/muscles using the standard phenol/chloroform method.

    The sibling taxa of Chinese Bamboo Partridge is Gallus gallus (Kimball et al., 1999). Therefore we selected a subset (n = 50) of G. gallus microsatellite primers for PCR amplification. PCR was carried out in a 30 μL mixture containing 100 ng DNA, 0.25 μM of each primer, 10× PCR buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP and 1U Taq polymerase (all reagents were from Dingguo Bio., Beijing, China). Amplification conditions were as follows: 94℃ for 4 min, then 94℃ for 30 s, annealing temperature for 15 s (Table 1), 72℃ for 20 s for 30 cycles, then 72℃ for 10 min in a PE9600 thermocycler. The PCR products were separated on an ABI377 PRISMTM DNA sequencer (ABI). Fragment lengths were assigned using Gene Scan software 3.1 (ABI). Of the 30 primer sets screened, 13 exhibited polymorphism (Table 1).

    Table  1.  Characteristics of ten polymorphic microsatellite loci in Bambusicola thoracica
    Locus ID Primer sequences Repeat
    motif
    Ta
    (℃)
    Observed allele size range (bp) Na HO HE p
    ADL268 F: CTCCACCCCTCTCAGAACTA
    R: CAACTTCCCATCTACCTACT
    (GT)12 60 90–120 5 0.6098 0.4788 0.0887
    ADL136 F: TGTCAAGCCCATCGTATCAC
    R: CCACCTCCTTCTCCTGTTCA
    (TG)20 56 98–134 13 0.7105 0.8898 0.0000*
    MCW0016 F: ATGGCGCAGAAGGCAAAGCGATAT
    R: TGGCTTCTGAAGCAGTTGCTATGG
    (TG)16 62 104–126 4 0.6000 0.4459 0.0942
    MCW067 F: GCACTACTGTGTGCTGCAGTTT
    R: GAGATGTAGTTGCCACATTCCGAC
    (TA)6 + (TG)11 56 162–188 11 0.5000 0.8060 0.0000*
    MCW069 F: GCACTCGAGAAAACTTCCTGCG
    R: TTGCTTCAGCAAGCATGGGAGGA
    (CA)11 58 152–166 8 0.7073 0.7148 0.1089
    MCW0111 F: GCTCCATGTGAAGTGGTTTA
    R: ATGTCCACTTGTCAATGATG
    (CA)7 57 80–102 9 1.0000 0.7338 0.0000*
    MCW0216 F: GGGTTTTACAGGATGGGACG
    R: AGTTTCACTCCCAGGGCTCG
    (GT)9 60 142–154 4 0.1220 0.1183 1.0000
    MCW222 F: GCAGTTACATTGAAATGATTCC
    R: TTCTCAAAACACCTAGAAGAC
    (GT)8 62 190–216 5 0.2439 0.2671 0.1000
    MCW0295 F: ATCACTACAGAACACCCTCTC
    R: TATGTATGCACGCAGATATCC
    (AC)10 + (AT)4 + (ATAC)3 60 86–144 4 0.5854 0.5086 0.6300
    LEI0192 F: TGCCAGAGCTTCAGTCTGT
    R: GTCATTACTGTTATGTTTATTGC
    (TTTC)12 56 250–376 12 0.4000 0.6671 0.0000*
    Ta, annealing temperature; Na, number of alleles; HE, expected heterozygosity; HO, observed heterozygosity.
    * means p < 0.05.
     | Show Table
    DownLoad: CSV

    For each polymorphic locus, we calculated the observed heterozygosity (HO) and expected heterozygosity (HE) using GENEPOP version 3.4 (Raymond and Rousset, 2000). GENEPOP was also used to test for evidence of linkage disequilibrium and deviation from the Hardy-Weinberg equilibrium.

    The number of alleles per locus was 4–13. The observed heterozygosity ranged from 0.1220 to 1.0000 and the expected heterozygosity from 0.1183 to 0.8898 (Table 1). The observed heterozygosity of all loci was consistent with that expected under the Hardy-Weinberg equilibrium after a Bonferroni correction (p < 0.05), except for ADL136, MCW067, LEI0166 and LEI0192. Fifteen pairs of loci showed significant linkage disequilibrium values at p < 0.05 among the 78 pair-wise tests. These markers are potentially useful for studies on phylogeography and conservation genetics of the Chinese Bamboo Partridge.

    We thank Mr Minsheng Liu for his assistance in obtaining samples. We also thank the Dingguo Bio. Ltd. for providing technological help. The study was supported by the National Natural Science Foundation of China (Grant No. 30760036, 30960051), Young Scientists (Jinggang Star) Training Scheme of Jiangxi Province, and Natural Science Foundation of Jiangxi Province (2009GZN0075).

  • Aliat T, Kaabeche M, Khomri H, Nouri L, Neffar S, Chenchouni H. A pedological characterisation of some inland wetlands and Ramsar sites in Algeria. Land Degrad Dev. 2016;27:693-705. .
    Baldassarre GA, Bolen EG. Waterfowl ecology and management. Malabar: Kreiger Publishing; 2006.
    Balla A. Synthèse écologique globale des zones humides d'importance internationale "Sites Ramsar" en Algérie. Ecology Engineer dissertation, University of Batna, Algeria; 2012.
    Bellagoune S. Hivernage du Tadorne de Belon Tadorna tadorna (Anatidés) dans la sebkha de Djendli (Batna, Est algérien). Doctoral Thesis. University of Annaba, Algeria; 2015.
    Benabderrahmane MC, Chenchouni H. Assessing environmental sensitivity areas to desertification in Eastern Algeria using Mediterranean desertification and land use "MEDALUS" model. Int J Sustain Water Environ Syst. 2010;1:5-10.
    Bensizerara D. Ecologie des oiseaux de Sabkhat Djendli. Doctoral Thesis. University of Biskra, Algeria; 2014.
    Bensizerara D, Chenchouni H, Si Bachir A, Houhamdi M. Ecological status interactions for assessing bird diversity in relation to a heterogeneous landscape structure. Avian Biol Res. 2013;6:67-77.
    Bezzalla A, Houhamdi M, Chenchouni H. Vegetation analysis of Chott Tinsilt and Sebkhet Ezzemoul (two Ramsar sites in Algeria) in relation to soil parameters. In: Chenchouni H, Errami E, Rocha F, et al., editors. Exploring the nexus of geoecology, geography, geoarcheology and geotourism: advances and applications for sustainable development in environmental sciences and agroforestry research. Cham: Springer; 2019a. p. 38-41. .
    Bezzalla A, Houhamdi M, Maazi MC, Chenchouni H. Modeling climate influences on population dynamics and diurnal time-budget of the Shelduck (Tadorna tadorna) wintering in Ramsar wetlands of Algeria. Avian Biol Res. 2019b;1: 1. .
    Bibby CJ, Jones M, Marsden S. Bird surveys. London: Expedition Advisory Centre; 1998.
    Bouchaala L, Elafri A, Charchar N, Boukhemza M, Houhamdi M. Wintering behaviour and spatial ecology of Eurasian Wigeon Anas penelope in a coastal Mediterranean wetland complex (Guerbes-Sanhadja) of northeastern Algeria. Avian Biol Res. 2017;10:84-91.
    Boulkhssaim M. Ecologie du tadorne dans les zones humides des hautes pleines de l'Est Algérien. Doctoral thesis. University of Annaba, Algeria; 2008.
    Boulkhssaim M, Houhandi M, Samraoui B. Status and diurnal behaviour of the Shelduck Tadorna tadorna in the Hauts Plateaux, northeast Algeria. Wildfowl. 2006;56:65-78.
    Caraco T. Time budgeting and group size: a theory. Ecology. 1979;60:611-7.
    Chenchouni H. Diagnostic écologique d'un site propose Ramsar: Chott Djendli (Batna-Algérie). Engineer Dissertation in Ecology. University of Batna, Algeria; 2007. .
    Chenchouni H. Diagnostic écologique et évaluation du patrimoine biologique du Lac Ayata (La Vallée de l'Oued Righ: Sahara septentrional algérien). Magiter Dissertation. University of Ouargla, Algeria; 2010a. .
    Chenchouni H. Drought-induced mass mortality of Atlas cedar forest (Cedrus atlantica) in Algeria. In: Parrota JA, Carr MA, editors. The International Forestry Review, 33th IUFRO World Congress. 23-28/Aug/2010, Seoul, Korea; 2010b.
    Chenchouni H. Statuts de protection et de conservation des oiseaux recensés dans les Aurès et ses alentours (nord-est algérien). Proceedings of the international Conference "SIBFA". University of Ouargla, Algeria; 2010c. p. 56-75. .
    Chenchouni H. Diversity assessment of vertebrate fauna in a wetland of hot hyperarid lands. Arid Ecosyst. 2012;2:253-63. .
    Chenchouni H. Contribution à l'étude de la bio-écologie de la Cigogne blanche (Ciconia ciconia) dans la région de Batna (Nord-est algérien). Doctoral thesis, University of Batna 2, Algeria; 2017a.
    Chenchouni H. Edaphic factors controlling the distribution of inland halophytes in an ephemeral salt lake "Sabkha ecosystem" at North African semi-arid lands. Sci Total Environ. 2017b;575: 660-71. .
    Chenchouni H, Menasria T, Neffar S, Chafaa S, Bradai L, Chaibi R, et al. Spatiotemporal diversity, structure and trophic guilds of insect assemblages in a semi-arid Sabkha ecosystem. PeerJ. 2015;3:e860. .
    Cherkaoui SI, Selmi S, Hanane S. Ecological factors affecting wetland occupancy by breeding Anatidae in the southwestern Mediterranean. Ecol Res. 2017;32:259-69.
    Cherry MJ, Barton BT. Effects of wind on predator-prey interactions. Food Webs. 2017;13:92-7.
    Chown D, Linsley M. Wetlands in Northern Algeria and Coastal Tunisia. An RSPB Waterfowl survey December 1991 to March 1992. Sandy: Royal Society for the Protection of Birds (RSPB); 1994.
    Crawley MJ. The R Book. 2nd ed. Chichester: Wiley; 2013. p. 681-714.
    Delany S, Scott S. Waterbird population estimates. Third Edition. Wetlands International Global Series No. 12. Wageningen: Wetlands International; 2002.
    Finlayson CM, Everard M, Irvine K, McInnes R, Middleton B, van Dam A, Davidson NC, editors. The wetland book. I: structure and function, management, and methods. Dordrecht: Springer; 2018.
    Geraci J, Béchet A, Cézilly F, Ficheux S, Baccetti N, Samraoui B, Wattier R. Greater flamingo colonies around the Mediterranean form a single interbreeding population and share a common history. J Avian Biol. 2012;43:341-54.
    Henriksen MV, Hangstrup S, Work F, Krogsgaard MK, Groom GB, Fox AD. Flock distributions of Lesser Flamingos Phoeniconaias minor as potential responses to food abundance-predation risk trade-offs at Kamfers Dam, South Africa. Wildfowl. 2015;65:3-18.
    Houhamdi M, Samraoui B. Diurnal time budget of wintering Teal Anas crecca at Lac des Oiseaux, northeast Algeria. Wildfowl. 2001;52:87-96.
    Houhamdi M, Samraoui B. Diurnal and nocturnal behaviour of Ferruginous duck Aythya nyroca at Lac des Oiseaux, northern Algeria. Ardeola. 2008;55:59-69.
    Isenmann P, Moali A. Les oiseaux d'Algérie—birds of Algeria. Paris: SEOF; 2000.
    Jensen GH, Tombre IM, Madsen J. Environmental factors affecting numbers of pink-footed geese Anser brachyrhynchus utilising an autumn stopover site. Wildl Biol. 2016;22:183-93.
    Johnson AR, Hafner H. Waterfowl census in autumn 1971 on some Tunisian and Algerian wetlands. Int Waterfowl Res Bur Bull. 1972;33:51-62.
    Ledant JP, Jacob JP, Jacob P, Malher F, Ochando B, Roche J. Mise à jour de l'avifaune Algérienne. Le Gerfaut. 1981;71:295-398.
    Metallaoui S, Houhamdi M. Données préliminaires sur l'avifaune aquatique de la Garaet Hadj-Tahar (Skikda, Nord-Est algérien). ABC Bull. 2008;15:71-6.
    Neffar S, Chenchouni H, Si Bachir A. Floristic composition and analysis of spontaneous vegetation of Sabkha Djendli in North-east Algeria. Plant Biosyst. 2016;150:396-403. .
    Oswald SA, Nisbet IC, Chiaradia A, Arnold JM. FlexParamCurve: R package for flexible fitting of nonlinear parametric curves. Methods Ecol Evol. 2012;3:1073-7.
    Öztürk M, Böer B, Barth HJ, Breckle SW, Clüsener Godt M, Khan MA. Sabkha ecosystems: volume III: Africa and Southern Europe. Dordrecht: Springer; 2011.
    Paracuellos M. How can habitat selection affect the use of a wetland complex by waterbirds? Biodivers Conserv. 2006;15:4569-82.
    Paulus SL. Time-activity budgets of nonbreeding Anatidae: a review. In: Weller MW, editor. Waterfowl in winter. Mineapolis: University of Minnesota Press; 1988. p. 135-52.
    R Core Team. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria; 2018. . Accessed 20 July 2018.
    Samraoui B, Samraoui F. An ornithological survey of Algerian wetlands: important Bird Areas, Ramsar sites and threatened species. Wildfowl. 2008;58:71-96.
    Sayoud MS, Salhi H, Chalabi B, Allali A, Dakki M, Qninba A, et al. The first coordinated trans-North African mid-winter waterbird census: the contribution of the International Waterbird Census to the conservation of waterbirds and wetlands at a biogeographical level. Biol Conserv. 2017;206:11-20.
    Tamisier A, Dehorter O. Camargue, Canards et Foulques. Fonctionnement d'un prestigieux quartier d'hiver. Nîmes: Centre Ornithologique du Gard; 1999.
    Walmsley JG. Wintering Shelduk Tadorna tadorna in the West Mediterranean. Supplemento Ricerche di Biologia della Selvaggina. 1986;10:339-51.
    Wetlands International. Waterbird population estimates. Fifth Edition. Summary Report. Wageningen, The Netherlands: Wetlands International; 2012. . Accessed 20 July 2018.
    Xu F, Liu G, Si Y. Local temperature and El Niño Southern Oscillation influence migration phenology of East Asian migratory waterbirds wintering in Poyang, China. Integr Zool. 2017;12:303-17.
  • Related Articles

Catalog

    Figures(8)  /  Tables(3)

    Article Metrics

    Article views (243) PDF downloads (8) Cited by()

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return